重组DNA的分离、克隆与测序实验手册

        ABI Forward primer sequence-
            20mer  5' GACGTTGTAAAACGACGGCC 3'
            18mer  5' TGTAAAACGACGGCCAGT 3'

 ABI Forward Aminolink-primer sequence-
  5' 5TG TAA AAC GAC GGC CAG T 3'

        ABI Reverse primer sequence-
            20mer  5' CACAGGAAACAGCTATGACC 3'
            18mer  5' CAGGAAACAGCTATGACC 3'

 ABI Reverse Aminolink-primer sequence-
  5' 5CA GGA AAC AGC TAT GAC C 3'

 400 mM Tris-HCl, pH 9.0   16 ml  1 M Tris-HCl, pH 9.0
 100 mM (NH4)2SO4, pH 9.0   4 ml  1 M (NH4)2SO4, pH 9.0
  25 mM MgCl2, pH 7.0       1 ml  1 M MgCl2, pH 7.0
  5% DMSO                   2 ml  DMSO
    17 ml
 ddH2O

    40 ml

2. Taq Dilution Buffer

 400 mM Tris-HCl, pH 9.0 16 ml 1 M Tris-HCl, pH 9.0
 100 mM (NH4)2SO4, pH 9.0 4 ml 1 M (NH4)2SO4, pH 9.0
 25 mM MgCl2, pH 7.0 1 ml 1 M MgCl2, pH 7.0
     19 ml
 ddH2O

     40 ml

3. 50:1 TE

     50 mM Tris-HCl, pH 7.6  0.5 ml 1 M Tris-HCl, pH 7.6
      1 mM Na2EDTA, pH 8.0  0.1 ml 0.1 M Na2EDTA, pH 8.0
     9.6 ml
 ddH2O

     10 ml

4. Fluorescent Labeled Primers

Prepare a 100 X stock solution (40 uM); an example calculation for a dry tube of an 18mer with an O.D. of 1.00 is shown below (remembering that Joe is the dye-labeled primer for the A reaction, Fam is for C, Tamra is for G, and Rox is for T):

1.00 OD(37 ug/OD)(mol x mer/320 g)(10+12pmol/mol)(g/10+6ug)

(1/18 mer)(ul/40 pmoles)=x ul

In this example x=160 ul, and 160 ul of ddH20 should be added to the dried tube of fluorescent primer for a concentration of 40 uM (40 pmol/ul). From this 100X stock of 40 uM make 1:100 dilutions. To make the amount of primer aliquoted the same as the amount of mixes per batch:

Dilute either fluorescent forward or reverse primers as follows:

 64 ul of 40 uM A or C primer 128 ul of 40 uM G or T primer
 6.3 ml ddH2O     12.7 ml ddH2O
 6.4 ml
    12.8 ml

 

5. 5X Taq Cycle Sequencing Mixes Working dilutions of 20 mM are made for dATP, dCTP, and dTTP based on using one complete tube of 20 mM stock per batch of mixes. 7deaza-dGTP is purchased at a concentration of 10 mM (1080 ul are needed for one batch each of A, C, G, and T mixes, so slightly more than five tubes will be needed-each tube contains 200 ul).

 20 mM dATP
  20 mM dCTP
  20 mM dTTP

 95 ul of 100 mM dATP 95 ul of 100 mM dCTP 80 ul of 100 mM dTTP
 47.5 ul of 50:1 TE 47.5 ul of 50:1 TE 40 ul of 50:1 TE
 332.5 
ul ddH2O
  332.5 
ul ddH2O
  280 
ul ddH2O

 475 ul   475 ul   400 ul

  A
 C
 G
 T

dATP  62.5 uM 250 uM 250 uM  250 uM
dCTP  250 uM  62.5 uM 250 uM  250 uM
7-dGTP 375 uM  375 uM 94  uM  375 uM
dTTP  250 uM  250 uM 250 uM 62.5 uM
ddATP  1.5 mM -- --  --
ddCTP  -- 0.75 mM --  --
ddGTP  -- -- 0.125 mM --
ddTTP  -- -- -- 1.25 mM
 
 For one batch (200 tubes) of each nucleotide mix:

  A
 C
 G
 T

20 mM dATP 20 ul 80 ul 160 ul  160 ul
20 mM dCTP 80 ul  20 ul  160 ul  160 ul
10 mM 7-dGTP 240 ul  240 ul 120 ul  480 ul
20 mM dTTP 80 ul 80 ul 160 ul 40 ul
5 mM ddATP 1920 ul -- -- --
5 mM ddCTP -- 960 ul -- --
5 mM ddGTP -- -- 320 ul --
5 mM ddTTP -- -- -- 3200 ul
50:1 TE 640 ul 640 ul 1280 ul 1280 ul
ddH2O  3420 ul
 4380 ul
 10600 ul
7480 ul

  6400 ul 6400 ul 12800 ul12800 ul

Ordering information:

100 mM dATP 27-2050-01   $48   Pharmacia 25 umoles 250 ul
100 mM dCTP 27-2060-01   $48   Pharmacia 25 umoles 250 ul
10 mM c7dGTP 988 537      $98   Boehringer 2 umoles  200 ul
100 mM dTTP 27-2080-01   $48   Pharmacia 25 umoles 250 ul
5 mM ddATP 27-2057-00   $25   Pharmacia 0.5 umoles 100 ul
5 mM ddCTP 27-2065-00   $25   Pharmacia 0.5 umoles 100 ul
5 mM ddGTP 27-2075-00   $25   Pharmacia 0.5 umoles 100 ul
5 mM ddTTP 27-2085-00   $25   Pharmacia 0.5 umoles 100 ul
Micro PCR tubes 1044-20-0 $90  Robbins 1000/bag 10 rxn/bag
StripEase caps 1044-10-0 $65  Robbins  300/bag 25 rxn/bag

At present, we are using the following primers:

Universal Forward 20mer 5' GTTGTAAAACGACGGCCAGT 3'

Universal Reverse 20mer 5' CACAGGAAACAGCTATGACC 3'

The following primers also have been used in the past:

ABI Forward primer sequence-

20mer 5' GACGTTGTAAAACGACGGCC 3'

18mer 5' TGTAAAACGACGGCCAGT 3'

ABI Reverse primer sequence-

20mer 5' CACAGGAAACAGCTATGACC 3'

18mer 5' CAGGAAACAGCTATGACC 3'

T7: 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'

SP6:5'-ATT-TAG-GTG-ACA-CTA-TAG-AA-3'

M13 (-21) universal forward 5'-TGT-AAA-ACG-ACG-GCC-AGT-3'

M13 (-40) universal forward 5'-GTT-TTC-CCA-GTC-ACG-AC-3'

M13/pUC reverse primer 5'-CAG-GAA-ACA-GCT-ATG-ACC-3'

T7 primer 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'

SP6 primer 5'-ATT-TAG-GTG-ACA-CTA-TAG-3'

-16bs 5'-TCG-AGG-TCG-ACG-GTA-TCG-3'

+19bs 5'-GCC-GCT-CTA-GAA-CTA-GTG-3'

As they are read on DNA sequencing gels using the Universal primer:

M13mp7
.......EcoR1....BamH1.SalI..PstI..SalI..BamH1....EcoR1
GGCCAGTGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGATCCGGGGAATTC

M13mp8
..........HindIII.PstI.SalI...BamH1.SmaI.EcoR
GGCCAGTGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCGTAATCATG

M13mp9
.......EcoR1.SmaI.BamH1..SalI..PstI..HindIII
GGCCAGTGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCGTAATCATG

M13mp10 ...HindIII..PstI..SalI..XbaI..BamH1..SmaI..SstI..EcoR1 GCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTCG M13mp11 ...EcoR1..SstI..SmaI..BamH1..XbaI..SalI..PstI..HindIII GTGAATTCGAGCTCGCCCGGGGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTGG M13mp18 HindIII.SphI..PstI..SalI.XbaI.BamH1.SmaI.KpnI.SstI.EcoR1 AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC M13mp19 EcoR1.SstI.KpnI.SmaI.BamH1.XbaI.SalI.PstI..SphI..HindIII GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT

Common Assay Incub. Recognition

Enzyme isoschizomers buffer temp. site Cloning sites

Bacterial transformation is the process by which bacterial cells take up naked DNA molecules. If the foreign DNA has an origin of replication recognized by the host cell DNA polymerases, the bacteria will replicate the foreign DNA along with their own DNA. When transformation is coupled with antibiotic selection techniques, bacteria can be induced to uptake certain DNA molecules, and those bacteria can be selected for that incorporation. Bacteria which are able to uptake DNA are called "competent" and are made so by treatment with calcium chloride in the early log phase of growth. The bacterial cell membrane is permeable to chloride ions, but is non-permeable to calcium ions. As the chloride ions enter the cell, water molecules accompany the charged particle. This influx of water causes the cells to swell and is necessary for the uptake of DNA. The exact mechanism of this uptake is unknown. It is known, however, that the calcium chloride treatment be followed by heat. When E. coli are subjected to 42degC heat, a set of genes are expressed which aid the bacteria in surviving at such temperatures. This set of genes are called the heat shock genes. The heat shock step is necessary for the uptake of DNA. At temperatures above 42degC, the bacteria's ability to uptake DNA becomes reduced, and at extreme temperatures the bacteria will die.

The process for the uptake of naked plasmid and bacteriophage DNA is the same; calcium chloride treatment of bacterial cells produces competent cells which will uptake DNA after a heat shock step. However, there is a slight, but important difference in the procedures for transformation of plasmid DNA and bacteriophage M13 DNA. In the plasmid transformation, after the heat shock step intact plasmid DNA molecules replicate in bacterial host cells. To help the bacterial cells recover from the heat shock, the cells are briefly incubated with non-selective growth media. As the cells recover, plasmid genes are expressed, including those that enable the production of daughter plasmids which will segregate with dividing bacterial cells. However, due to the low number of bacterial cells which contain the plasmid and the potential for the plasmid not to propogate itself in all daughter cells, it is necessary to select for bacterial cells which contain the plasmid. This is commonly performed with antibiotic selection. E. coli strains such as GM272 are sensitive to common antibiotics such as ampicillin. Plasmids used for the cloning and manipulation of DNA have been engineered to harbor the genes for antibiotic resistance. Thus, if the bacterial transformation is plated onto media containing ampicillin, only bacteria which possess the plasmid DNA will have the ability to metabolize ampicillin and form colonies. In this way, bacterial cells containing plasmid DNA are selected.

The transformation of bacteriophage M13 into bacterial cells is identical to plasmid DNA transformation through the heat shock step. After the heat shock step, single stranded M13 DNA begins replicating in the host cell through use of the host cell machinery. During the life cycle of this virus, however, M13 replicative form is created and daughter phages are packaged and extruded from the bacterial cell. These intact phage molecules then infect neighboring bacteria in a process called transfection. When these transformed and transfected bacteria are plated with non-infected cells onto growth media, the non-infected cells form a background cell lawn which covers the plate. In regions of M13 transfection, areas of slowed growth, called plaques, can be identified as opaque regions which interrupt the lawn.

Since M13 viral transfection is a critical part of the transformation of bacterial cells with M13, it is absolutely necessary to use a strain of E. coli which harbors the episome for the F pilus. When M13 phages infect bacterial cells they attach to the F pilus, and the loss of this pilus is a common reason for a failed or poor transformation/transfection of M13. JM101 is a strain of E. coli which possesses the F pilus if the culture is maintained under appropriate conditions. Since the F pilus is not necessary for plasmid DNA transformation, it is advisable to use GM272, a much healthier, F- strain of E. coli for this procedure. To avoid confusion between the similar procedures, bacterial transformation with plasmid DNA is termed a "Transformation", and a bacterial transformation with naked M13 followed by a transfection with intact M13 phage is called a "Transfection."

An additional level of selection can be achieved during transformation and transfections. Bacterial cells containing plasmids with the antibiotic resistance gene are selected in bacterial transformations, and cells in an area of M13 infection are recognized as plaques against a lawn of non-infected cells. However, the object of most transformations and transfections is to clone foreign DNA of interest into a known plasmid or viral vector and to isolate cells containing those recombinant molecules from each other and from those containing the non-recombinant vector. The E. coli lacZ operon has been incorporated into several cloning vectors, including plasmid pUC and bacteriophage M13. The polylinker regions of these vectors was engineered inside of the lacZ gene coding region, but in a way not to interrupt the reading frame or the functionality of the resultant lacZ gene protein product. This protein product is a galactosidase. In recombinant vectors which have an insert DNA molecule cloned into one of the restriction enzyme sites in the polylinker, this insert DNA results in an altered lacZ gene and a non-functional galactosidase. The presence or absence of this protein can easily be determined through the use of a simple chromogenic assay using IPTG and X-Gal. IPTG is the lacZ gene inducer and is necessary for the production of the galactosidase. The usual substrate for the lacZ gene protein product is galactose, which is metabolized into lactose and glucose. X-Gal is a colorless, modified galactose sugar. When this molecule is metabolized by the galactosidase, the resultant products are a bright blue color.

When IPTG and X-Gal are included in a plasmid DNA transformation, blue colonies represent bacteria harboring non-recombinant pUC vector DNA since the lacZ gene region is intact. IPTG induces production of the functional galactosidase which cleaves X-Gal and results in a blue colored metobolite. It follows that colorless colonies contain recombinant pUC DNA since a nonfunctional galactosidase is induced by IPTG which is unable to cleave the X-Gal. Similarly, for bacteriophage transfections, colorless plaques indicate regions of infection with recombinant M13 viruses, and blue plaques represent infection with non-recombinant M13.

Host Mutation Descriptions:

ara Inability to utilize arabinose.

deoR Regulatory gene that allows for constitutive synthesis for genes involved in deoxyribose synthesis. Allows for the uptake of large plasmids.

endA DNA specific endonuclease I. Mutation shown to improve yield and quality of DNA from plasmid minipreps.

F' F' episome, male E. coli host. Necessary for M13 infection.

galK Inability to utilize galactose.

galT Inability to utilize galactose.

gyrA Mutation in DNA gyrase. Confers resistance to nalidixic acid.

hfl High frequency of lysogeny. Mutation increases lambda lysogeny by inactivating specific protease.

lacI Repressor protein of lac operon. LacI[q] is a mutant lacI that overproduces the repressor protein.

lacY Lactose utilization; galactosidase permease (M protein).

lacZ b -D-galactosidase; lactose utilization. Cells with lacZ mutations produce white colonies in the presence of X-gal; wild type produce blue colonies.

lacZdM15 A specific N-terminal deletion which permits the a -complementation segment present on a phagemid or plasmid vector to make functional lacZ protein.

Dlon Deletion of the lon protease. Reduces degradation of b-galactosidase fusion proteins to enhance antibody screening of l libraries.

malA Inability to utilize maltose.

proAB Mutants require proline for growth in minimal media.

recA Gene central to general recombination and DNA repair. Mutation eliminates general recombination and renders bacteria sensitive to UV light.

rec BCD Exonuclease V. Mutation in recB or recC reduces general recombination to a hundredth of its normal level and affects DNA repair.

relA Relaxed phenotype; permits RNA synthesis in the absence of protein synthesis.

rspL 30S ribosomal sub-unit protein S12. Mutation makes cells resistant to streptomycin. Also written strA .

recJ Exonuclease involved in alternate recombination pathways of E. coli .

strA See rspL.

sbcBC Exonuclease I. Permits general recombination in recBC mutants.

supE Supressor of amber (UAG) mutations. Some phage require a mutation in this gene in order to grow.

supF Supressor of amber (UAG) mutations. Some phage require a mutation in this gene in order to grow.

thi-1 Mutants require vitamin B1(thiamine) for growth on minimal media.

traD36 mutation inactivates conjugal transfer of F' episome.

umuC Component of SOS repair pathway.

uvrC Component of UV excision pathway.

xylA Inability to utilize xylose.

Restriction and Modification Systems

dam DNA adenine methylase/ Mutation blocks methylation of Adenine residues in the recognition sequence 5'-undefinedATC-3' ~undefined=methylated)

dcm DNA cytosine methylase/Mutation blocks methylation of cytosine residues in the recognition sequences 5'-undefinedCAGG-3' or 5'-undefinedCTGG-3' ~undefined=methylated)

hsdM E. coli methylase/ Mutation blocks sequence specific methylation A[N6~undefinedACNNNNNNGTGC or GC [N6~undefinedACNNNNNNGTT ~undefined=methylated). DNA isloated from a HsdM[-] strain will be restricted by a HsdR[+]host.

hsd R17 Restriction negative and modification positive.

(rK[-], mK[+]) Allows cloning of DNA without cleavage by endogenous restriction endonucleases. DNA prepared from hosts with this marker can efficiently transform rK[+ ]E. coli hosts.

hsdS20 Restriction negative and modification negative.

(rB[-,] mB[-]) Allows cloning of DNA without cleavage by endogenous restriction endonucleases . DNAprepared from hosts with this marker is unmethylated by the hsd S20 modificationsystem.

mcrA E. coli restriction system/ Mutation prevents McrA restriction of methylated DNA of sequence 5'-undefinedCGG ~undefined=methylated).

mcrCB E. coli restriction system/ Mutation prevents McrCB restriction of methylated DNA of sequence 5'-G[5~undefinedC, 5'-G[5h~undefinedC, or 5'-G[N4~undefinedC ~undefined=methylated).

mrr E. coli restriction system/ Mutation prevents Mrr restriction of methylated DNA of sequence 5'-undefinedAC or 5'-undefinedAG ~undefined=methylated). Mutation also prevents McrF restriction of methylated cytosine sequences.

Other Descriptions:

cm[r] Chloramphenicol resistance

kan[r] Kanamycin resistance

Tetracycline resistance

Streptomycin resistance

Indicates a deletion of genes following it.

Tn10

A transposon that normally codes for tetrTn5

A transposon that normally codes for kan[r]

spi[-] Refers to red[-]gam[-]mutant derivatives of lambda defined by their ability to form plaques on E. coli P2 lysogens.

Reference: Bachman, B.J. (1990) Microbiology Reviews 54: 130- 197.

C600 - F-, e14, mcrA, thr-1 supE44, thi-1, leuB6, lacY1, tonA21, [[lambda]] [-]

-for plating lambda (gt10) libraries, grows well in L broth, 2x TY, plate on NZYDT+Mg.

-Huynh, Young, and Davis (1985) DNA Cloning, Vol. 1 , 56-110.

DH1 - F[-], recA1, endA1, gyrA96, thi-1, hsdR17 (rk[-], mk[+], supE44, relA1, [[lambda]][-]

]-for plasmid transformation, grows well on L broth and plates.

-Hanahan (1983) J. Mol. Biol. 166, 557-580.

XL1Blue-MRF' - D(mcrA)182, D(mcrCB-hsdSMR-mrr)172,endA1, supE44, thi-1, recA, gyrA96, relA1, lac, l-, [F'proAB, lac I[q]ZDM15, Tn10 (tet[r])] -For plating or glycerol stocks, grow in LB with 20 ug/ml of tetracycline. For transfection, grow in tryptone broth containing 10 mM MgSO4 and 0.2% maltose. (No antibiotic--Mg2+ interferes with tetracycline action.) For picking plaques, grow glycerol stock in LB to an O.D. of 0.5 at 600 nm (2.5 hours?). When at 0.5, add MgSO4 to a final concentration of 10 mM.

SURE Cells - Stratagene - e14(mcrA), D(mcrCB- hsdSMR-mrr)171, sbcC, recB, recJ, umuC::Tn5 (kan[r]), uvrC, supE44, lac, gyrA96, relA1, thi-1, end A1[F'proAB, lacI[q]DM15, Tn10(tet[r])]. An uncharacterized mutation enhances the a[-] complementation to give a more intense blue color on plates containing X-gal and IPTG.

GM272 - F[-], hsdR544 (rk[-], mk[-]), supE44, supF58, lacY1 or [[Delta]]lacIZY6, galK2, galT22, metB1m, trpR55, [[lambda]][-]

-for plasmid transformation, grows well in 2x TY, TYE, L broth and plates.

-Hanahan (1983) J. Mol. Biol. 166, 557-580.

HB101 - F[-], hsdS20 (rb[-], mb[-]), supE44, ara14, galK2, lacY1, proA2, rpsL20 (str[R]), xyl-5, mtl-1, [[lambda]][-], recA13, mcrA(+), mcrB(-)

-for plasmid transformation, grows well in 2x TY, TYE, L broth and plates.

-Raleigh and Wilson (1986) Proc. Natl. Acad. Sci. USA 83, 9070-9074.

JM101 - supE, thi, [[Delta]](lac-proAB), [F', traD36, proAB, lacIqZ[[Delta]]M15], restriction: (rk[+], mk[+]), mcrA+

-for M13 transformation, grow on minimal medium to maintain F episome, grows well in 2x TY, plate on TY or lambda agar.

-Yanisch-Perron et al. (1985) Gene 33, 103-119.

XL-1 blue recA1, endA1, gyrA96, thi, hsdR17 (rk[+], mk[+]), supE44, relA1, [[lambda]][-], lac, [F', proAB, lacIqZ[[Delta]]M15, Tn10 (tet[R])]

-for M13 and plasmid transformation, grow in 2x TY + 10 ug/ml Tet, plate on TY agar + 10 ug/ml Tet (Tet maintains F episome).

-Bullock, et al. (1987) BioTechniques 5, 376-379.

GM2929 - from B. Bachman, Yale E.coli Genetic Stock Center (CSGC#7080); M.Marinus strain; sex F[-];(ara-14, leuB6, fhuA13, lacY1, tsx-78, supE44, [glnV44], galK2, galT22, l[-], mcrA, dcm-6, hisG4,[Oc], rfbD1, rpsL136, dam-13::Tn9, xyl-5, mtl-1, recF143, thi-1, mcrB, hsdR2.)

MC1000 - (araD139, D[ara-leu]7679, galU, galK, D[lac]174, rpsL, thi-1). obtained from the McCarthy lab at the University of Oklahoma.

ED8767 (F-,e14-[mcrA],supE44,supF58,hsdS3[rB[-]mB[-]], recA56, galK2, galT22,metB1, lac-3 or lac3Y1 , obtained from Nora Heisterkamp and used as the host for abl and bcr cosmids.

Notes on Restriction/Modification Bacterial Strains:

1. EcoK (alternate=EcoB)-hsdRMS genes=attack DNA not protected by adenine methylation. (ED8767 is EcoK methylation minus). (1)

2. mcA (modified cytosine restriction), mcrBC, and mrr=methylation requiring systems that attack DNA only when it IS methylated (Ed8767 is mrr+, so methylated adenines will be restricted. Clone can carry methylation activity.) (1)

3. In general, it is best to use a strain lacking Mcr and Mrr systems when cloning genomic DNA from an organism with methylcytosine such as mammals, higher plants , and many prokaryotes. (2)

4. The use of D(mrr-hsd-mcrB) hosts=general methylation tolerance and suitability for clones with N6 methyladenine as well as 5mC (as with bacterial DNAs). (3)

5. XL1-Blue MRF'=D(mcrA)182, D(mcrCB-hsdSMR-mrr)172,endA1, supE44, thi-1, recA, gyrA96, relA1, lac, l-, [F' proAB, lacI[q]ZDM15, Tn10(tet[r]

REFERENCES:

1. Bickle, T. (1982) in Nucleases eds Linn, S.M. and Roberts, R.G. (CSH, NY) p. 95-100.

2. Erlich, M. and Wang, R.Y. (1981) Science 212, 1350-1357.

3. Woodcock, D.M. et al, (1989) Nucleic Acids Res ., 17,3469-3478.

[NextPage]

Units:

1 mg = 10-3 g.
1 ug = 10-6 g.
1 ng = 10-9 g.
1 pg = 10-12 g.

1 kb of DNA = 6.5 x10+5 Daltons of duplex DNA (sodium salt)
 = 3.3 x10+5 Daltons of single-stranded DNA (sodium salt)
 = 3.4 x10+5 Daltons of single-stranded RNA (sodium salt)

Average MW of a deoxynucleotide base = 324.5 Daltons
Average MW of a deoxynucleotide base pair = 649 Daltons

1 ug/ml of DNA = 3.08 uM phosphate
1 ug/ml of 1 kb of DNA = 3.08 nM 5' ends
1 mol of pBR322 = 2.83 x10+6 g.
1 pmol of linear pBR322, 5' ends = 1.4 ug
1 A260 unit of duplex DNA = 50 ug
1 A260 unit of single-stranded DNA = 37 ug
1 A260 unit of single-stranded RNA = 50 ug

1 kb of DNA = 333 amino acids of coding capacity
 = 37,000 daltons

Densities (50% GC):

  RF I (supercoiled)  ds DNA 1.709 g/ml
  RF II (nicked) ds DNA 1.54 g/ml
  ss DNA   1.726 g/ml
  ss RNA   1.90 g/ml
  protein   1.33 g/ml

Formulas

DNA melting point:

For duplex DNA >50 bp:

 Tm = 81.5deg. C +16.6 log (M of NaCl) + 0.41(% GC)
  - [500/bp of shortest chain in duplex]
  - [0.65(% formamide)]

For duplex DNA <50 bp:

 Add 2deg. C for each A or T
 Add 4deg. C for each G or C

Picomoles of ends:

 pmol ends per ug linear DNA = 3030/number of bases

1. Migration of marker dyes in native polyacrylamide non-denaturing gels

 Gel %
 Bromophenol blue (BP)
 Xylene cyanole (XC)


   3.5   100   460
   5.0    65   260
   8.0    45   160
  12.0    20    70
  20.0    12    45

2. Migration of marker dyes in polyacrylamide denaturing gels

 Gel %
 Bromophenol blue (BP)
 Xylene cyanole (XC)


   5.0  35   130
   6.0  26   106
   8.0  19    75
  10.0  12    55
  20.0   8    28

The exact distance between bands is influenced by percentage of agarose, time of electrophoresis, concentration of Ethidium bromide, degree of supercoiling and the size and complexity of the DNA.

                      Second base

One and three-letter amino acid symbols

Alanine    Ala A
Arginine   Arg R
Asparagine   Asn N
Aspartic acid  Asp D
Asparagine or Aspartic acid Asx B
Cysteine   Cys C
Glutamine   Gln Q
Glutamic acid   Glu E
Glutamine or Glutamic acid Glx Z
Glycine          Gly G
Histidine   His H
Isoleucine   Ile I
Leucine   Leu L
Lysine   Lys K
Methionine   Met M
Phenylalanine   Phe F
Proline   Pro P
Serine   Ser S
Threonine   Thr T
Tryptophan   Trp W
Tyrosine   Tyr Y
Valine   Val V

        ABI Forward primer sequence-
            20mer  5' GACGTTGTAAAACGACGGCC 3'
            18mer  5' TGTAAAACGACGGCCAGT 3'

 ABI Forward Aminolink-primer sequence-
  5' 5TG TAA AAC GAC GGC CAG T 3'

        ABI Reverse primer sequence-
            20mer  5' CACAGGAAACAGCTATGACC 3'
            18mer  5' CAGGAAACAGCTATGACC 3'

 ABI Reverse Aminolink-primer sequence-
  5' 5CA GGA AAC AGC TAT GAC C 3'

 400 mM Tris-HCl, pH 9.0   16 ml  1 M Tris-HCl, pH 9.0
 100 mM (NH4)2SO4, pH 9.0   4 ml  1 M (NH4)2SO4, pH 9.0
  25 mM MgCl2, pH 7.0       1 ml  1 M MgCl2, pH 7.0
  5% DMSO                   2 ml  DMSO
    17 ml
 ddH2O

    40 ml

2. Taq Dilution Buffer

 400 mM Tris-HCl, pH 9.0 16 ml 1 M Tris-HCl, pH 9.0
 100 mM (NH4)2SO4, pH 9.0 4 ml 1 M (NH4)2SO4, pH 9.0
 25 mM MgCl2, pH 7.0 1 ml 1 M MgCl2, pH 7.0
     19 ml
 ddH2O

     40 ml

3. 50:1 TE

     50 mM Tris-HCl, pH 7.6  0.5 ml 1 M Tris-HCl, pH 7.6
      1 mM Na2EDTA, pH 8.0  0.1 ml 0.1 M Na2EDTA, pH 8.0
     9.6 ml
 ddH2O

     10 ml

4. Fluorescent Labeled Primers

Prepare a 100 X stock solution (40 uM); an example calculation for a dry tube of an 18mer with an O.D. of 1.00 is shown below (remembering that Joe is the dye-labeled primer for the A reaction, Fam is for C, Tamra is for G, and Rox is for T):

1.00 OD(37 ug/OD)(mol x mer/320 g)(10+12pmol/mol)(g/10+6ug)

(1/18 mer)(ul/40 pmoles)=x ul

In this example x=160 ul, and 160 ul of ddH20 should be added to the dried tube of fluorescent primer for a concentration of 40 uM (40 pmol/ul). From this 100X stock of 40 uM make 1:100 dilutions. To make the amount of primer aliquoted the same as the amount of mixes per batch:

Dilute either fluorescent forward or reverse primers as follows:

 64 ul of 40 uM A or C primer 128 ul of 40 uM G or T primer
 6.3 ml ddH2O     12.7 ml ddH2O
 6.4 ml
    12.8 ml

 

5. 5X Taq Cycle Sequencing Mixes Working dilutions of 20 mM are made for dATP, dCTP, and dTTP based on using one complete tube of 20 mM stock per batch of mixes. 7deaza-dGTP is purchased at a concentration of 10 mM (1080 ul are needed for one batch each of A, C, G, and T mixes, so slightly more than five tubes will be needed-each tube contains 200 ul).

 20 mM dATP
  20 mM dCTP
  20 mM dTTP

 95 ul of 100 mM dATP 95 ul of 100 mM dCTP 80 ul of 100 mM dTTP
 47.5 ul of 50:1 TE 47.5 ul of 50:1 TE 40 ul of 50:1 TE
 332.5 
ul ddH2O
  332.5 
ul ddH2O
  280 
ul ddH2O

 475 ul   475 ul   400 ul

  A
 C
 G
 T

dATP  62.5 uM 250 uM 250 uM  250 uM
dCTP  250 uM  62.5 uM 250 uM  250 uM
7-dGTP 375 uM  375 uM 94  uM  375 uM
dTTP  250 uM  250 uM 250 uM 62.5 uM
ddATP  1.5 mM -- --  --
ddCTP  -- 0.75 mM --  --
ddGTP  -- -- 0.125 mM --
ddTTP  -- -- -- 1.25 mM
 
 For one batch (200 tubes) of each nucleotide mix:

  A
 C
 G
 T

20 mM dATP 20 ul 80 ul 160 ul  160 ul
20 mM dCTP 80 ul  20 ul  160 ul  160 ul
10 mM 7-dGTP 240 ul  240 ul 120 ul  480 ul
20 mM dTTP 80 ul 80 ul 160 ul 40 ul
5 mM ddATP 1920 ul -- -- --
5 mM ddCTP -- 960 ul -- --
5 mM ddGTP -- -- 320 ul --
5 mM ddTTP -- -- -- 3200 ul
50:1 TE 640 ul 640 ul 1280 ul 1280 ul
ddH2O  3420 ul
 4380 ul
 10600 ul
7480 ul

  6400 ul 6400 ul 12800 ul12800 ul

Ordering information:

100 mM dATP 27-2050-01   $48   Pharmacia 25 umoles 250 ul
100 mM dCTP 27-2060-01   $48   Pharmacia 25 umoles 250 ul
10 mM c7dGTP 988 537      $98   Boehringer 2 umoles  200 ul
100 mM dTTP 27-2080-01   $48   Pharmacia 25 umoles 250 ul
5 mM ddATP 27-2057-00   $25   Pharmacia 0.5 umoles 100 ul
5 mM ddCTP 27-2065-00   $25   Pharmacia 0.5 umoles 100 ul
5 mM ddGTP 27-2075-00   $25   Pharmacia 0.5 umoles 100 ul
5 mM ddTTP 27-2085-00   $25   Pharmacia 0.5 umoles 100 ul
Micro PCR tubes 1044-20-0 $90  Robbins 1000/bag 10 rxn/bag
StripEase caps 1044-10-0 $65  Robbins  300/bag 25 rxn/bag

At present, we are using the following primers:

Universal Forward 20mer 5' GTTGTAAAACGACGGCCAGT 3'

Universal Reverse 20mer 5' CACAGGAAACAGCTATGACC 3'

The following primers also have been used in the past:

ABI Forward primer sequence-

20mer 5' GACGTTGTAAAACGACGGCC 3'

18mer 5' TGTAAAACGACGGCCAGT 3'

ABI Reverse primer sequence-

20mer 5' CACAGGAAACAGCTATGACC 3'

18mer 5' CAGGAAACAGCTATGACC 3'

T7: 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'

SP6:5'-ATT-TAG-GTG-ACA-CTA-TAG-AA-3'

M13 (-21) universal forward 5'-TGT-AAA-ACG-ACG-GCC-AGT-3'

M13 (-40) universal forward 5'-GTT-TTC-CCA-GTC-ACG-AC-3'

M13/pUC reverse primer 5'-CAG-GAA-ACA-GCT-ATG-ACC-3'

T7 primer 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'

SP6 primer 5'-ATT-TAG-GTG-ACA-CTA-TAG-3'

-16bs 5'-TCG-AGG-TCG-ACG-GTA-TCG-3'

+19bs 5'-GCC-GCT-CTA-GAA-CTA-GTG-3'

As they are read on DNA sequencing gels using the Universal primer:

M13mp7
.......EcoR1....BamH1.SalI..PstI..SalI..BamH1....EcoR1
GGCCAGTGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGATCCGGGGAATTC

M13mp8
..........HindIII.PstI.SalI...BamH1.SmaI.EcoR
GGCCAGTGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCGTAATCATG

M13mp9
.......EcoR1.SmaI.BamH1..SalI..PstI..HindIII
GGCCAGTGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCGTAATCATG

M13mp10 ...HindIII..PstI..SalI..XbaI..BamH1..SmaI..SstI..EcoR1 GCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTCG M13mp11 ...EcoR1..SstI..SmaI..BamH1..XbaI..SalI..PstI..HindIII GTGAATTCGAGCTCGCCCGGGGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTGG M13mp18 HindIII.SphI..PstI..SalI.XbaI.BamH1.SmaI.KpnI.SstI.EcoR1 AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC M13mp19 EcoR1.SstI.KpnI.SmaI.BamH1.XbaI.SalI.PstI..SphI..HindIII GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT

Common Assay Incub. Recognition

Enzyme isoschizomers buffer temp. site Cloning sites

Aat II  med 37 GACGT/C Aat II
Acc I   med 37 GT/(AC)(GT)AC Acc I, Cla I
Aha III Dra I med 37 TTT/AAA blunt
Alu I  med 37  AG/CT blunt
Asu II   37 TT/CGAA Acc I, Cla I
Ava I  med 37 C/YCGRG Sal I, Xho I, Xma I
Ava II  med 37 G/G(AT)CC 
Bal I  low 37 TGG/CCA blunt
BamH1  med 37 G/GATCC BamH1, Bgl II
Bgl I  med 37 GCCN4/NGGC
Bgl II  low 37 A/GATCT BamH1, Bgl II
BstE II  high 60 G/GTNACC
BstN I  low 55 CC/(AT)GG
Cla I  low 37 AT/CGAT Acc I, Cla I
Dra I Aha III low 37 TTT/AAA blunt
EcoR1  high 37 G/AATTC EcoR1
EcoRundefined  low 37   /AATT EcoR1
EcoRV  med 37 GAT/ATC blunt
Hae I  low 37 (AT)GG/CC(TA) blunt
Hae II  low 37 RGCGC/Y 
Hae III  med 37 GG/CC blunt
Hha I Cfo I, HinP1 med 37 GCG/C Hha I
Hinc II  med 37 GTY/RAC blunt
Hind III  med 37-55 A/AGCTT Hind III
Hinf I  med 37 G/ANTC
HinP1 Cfo I, Hha I low 37 G/CGC Acc I, Cla I
Hpa I  low 37 GTT/AAC blunt
Hpa II Msp I low 37 C/CGG Acc I, Cla I
Kpn I  low 37 GGTAC/C Kpn I
Mbo I Sau3A med  37   /GATC BamH1, Bgl II
Msp I  med 37 C/CGG Acc I, Cla I
Mst I Fsp I high 37 TGC/GCA blunt
Mst II Bsu36 I high 37 CC/TNAGG
Nae I  med 37 GCC/CCG blunt
Nco I  high 37 C/CATGG Nco I
Nde I  med 37 CA/TATG Nde I
Not I  high 37 GC/GGCCGC
Nru I  med 37 TCG/CGA blunt
Pst I  med 21-37 CTGCA/G Pst I
Pvu I  high 37 CGAT/CG Pvu I
Pvu II  med 37 CAG/CTG blunt
Rsa I  med 37   GT/AC blunt
Sac I Sst I low 37 GAGCT/C Sac I, Sst I
Sal I  high 37 G/TCGAC Ava I, Sal I, Xho I
Sau3A I Mbo I med 37  /undefinedATC BamH1, Bgl II
Sfi I   50 GGCCN4/NGGCC
Sma I Xma I (1) 37 CCC/GGG blunt
Sph I  high 37 GCATG/C Sph I
Sst I Sac I med  37 GAGCT/C Sst I, Sac I
Sst II Sac II med 37 CCGC/GG Sst II
Taq I  low 37-55 T/CGA AccI, Cla I
Tha I FnuD II, Acc II low 37-60   CG/CG blunt
Xba I  high 37 T/CTAGA Xba I
Xho I Ccr I high 37 C/TCGAG Ava I, Cla I
Xma I Sma I low 37 C/CCGGG Ava I, Xma I

Assay buffers (see enzyme vendors catalogs for additional information)

10x Low salt buffer
   10x Core buffer


   100mM Tris-HCl, pH 7.6 500mM NaCl
   100mM MgCl2            500mM Tris-HCl, pH 7.6
    10mM DTT              100mM MgCl2

10x Medium salt buffer
  10x Hind buffer


   500mM NaCl               600mM NaCl
   100mM Tris-HCl, pH 7.6   100mM Tris-HCl, pH 7.6
   100mM MgCl2               70mM MgCl2
    10mM DTT

10x High salt buffer 10x Sma I buffer (1) 1.0M NaCl 200mM KCl 500mM Tris-HCl, pH 7.6 100mM Tris-HCl, pH 7.6 100mM MgCl2 100mM MgCl2 10mM DTT 10mM DTT

The following enzymes CAN be heat inactivated by incubation at 65 deg. C for 10 min.

Alu I, Apa I, Ava II, Bal I, Bgl I, Cvn I, Dpn I, Dra I, Eco R II, Eco RV, Hae II, Hha I, Hinc II, Kpn I, Mbo I, Msp I, Nar I, Nde II, Rsa I, Sau 3a, Sca I, Sfi I, Spe I, Sph I, Ssp I, Sst I, Stu I, and Sty I.

The following enzymes are ONLY PARTIALLY heat inactivated by incubation at 65 deg.C for 10 min.

Ava I, Cfo I, Cla I, Cvn I, Eco RI, Mbo II, Mlu I, Nci I, Nru I, Pst I, Pvu II, Sma I and Xma III

The following enzymes CANNOT be heat inactivated by incubation at 65 deg. C for 10 min.

Acc I, Bam HI, Bcl I, Bgl II, BstE II, Dde I, Hae III, Hind III, Hinf I, Hpa I, Hpa II Nde I, Nhe I, Nsi I, Pvu I, Sal I, Sau 96 I, Sst II, Taq I, Tha I, Xba I, Xho I, and Xor II.

Bacterial transformation is the process by which bacterial cells take up naked DNA molecules. If the foreign DNA has an origin of replication recognized by the host cell DNA polymerases, the bacteria will replicate the foreign DNA along with their own DNA. When transformation is coupled with antibiotic selection techniques, bacteria can be induced to uptake certain DNA molecules, and those bacteria can be selected for that incorporation. Bacteria which are able to uptake DNA are called "competent" and are made so by treatment with calcium chloride in the early log phase of growth. The bacterial cell membrane is permeable to chloride ions, but is non-permeable to calcium ions. As the chloride ions enter the cell, water molecules accompany the charged particle. This influx of water causes the cells to swell and is necessary for the uptake of DNA. The exact mechanism of this uptake is unknown. It is known, however, that the calcium chloride treatment be followed by heat. When E. coli are subjected to 42degC heat, a set of genes are expressed which aid the bacteria in surviving at such temperatures. This set of genes are called the heat shock genes. The heat shock step is necessary for the uptake of DNA. At temperatures above 42degC, the bacteria's ability to uptake DNA becomes reduced, and at extreme temperatures the bacteria will die.

The process for the uptake of naked plasmid and bacteriophage DNA is the same; calcium chloride treatment of bacterial cells produces competent cells which will uptake DNA after a heat shock step. However, there is a slight, but important difference in the procedures for transformation of plasmid DNA and bacteriophage M13 DNA. In the plasmid transformation, after the heat shock step intact plasmid DNA molecules replicate in bacterial host cells. To help the bacterial cells recover from the heat shock, the cells are briefly incubated with non-selective growth media. As the cells recover, plasmid genes are expressed, including those that enable the production of daughter plasmids which will segregate with dividing bacterial cells. However, due to the low number of bacterial cells which contain the plasmid and the potential for the plasmid not to propogate itself in all daughter cells, it is necessary to select for bacterial cells which contain the plasmid. This is commonly performed with antibiotic selection. E. coli strains such as GM272 are sensitive to common antibiotics such as ampicillin. Plasmids used for the cloning and manipulation of DNA have been engineered to harbor the genes for antibiotic resistance. Thus, if the bacterial transformation is plated onto media containing ampicillin, only bacteria which possess the plasmid DNA will have the ability to metabolize ampicillin and form colonies. In this way, bacterial cells containing plasmid DNA are selected.

The transformation of bacteriophage M13 into bacterial cells is identical to plasmid DNA transformation through the heat shock step. After the heat shock step, single stranded M13 DNA begins replicating in the host cell through use of the host cell machinery. During the life cycle of this virus, however, M13 replicative form is created and daughter phages are packaged and extruded from the bacterial cell. These intact phage molecules then infect neighboring bacteria in a process called transfection. When these transformed and transfected bacteria are plated with non-infected cells onto growth media, the non-infected cells form a background cell lawn which covers the plate. In regions of M13 transfection, areas of slowed growth, called plaques, can be identified as opaque regions which interrupt the lawn.

Since M13 viral transfection is a critical part of the transformation of bacterial cells with M13, it is absolutely necessary to use a strain of E. coli which harbors the episome for the F pilus. When M13 phages infect bacterial cells they attach to the F pilus, and the loss of this pilus is a common reason for a failed or poor transformation/transfection of M13. JM101 is a strain of E. coli which possesses the F pilus if the culture is maintained under appropriate conditions. Since the F pilus is not necessary for plasmid DNA transformation, it is advisable to use GM272, a much healthier, F- strain of E. coli for this procedure. To avoid confusion between the similar procedures, bacterial transformation with plasmid DNA is termed a "Transformation", and a bacterial transformation with naked M13 followed by a transfection with intact M13 phage is called a "Transfection."

An additional level of selection can be achieved during transformation and transfections. Bacterial cells containing plasmids with the antibiotic resistance gene are selected in bacterial transformations, and cells in an area of M13 infection are recognized as plaques against a lawn of non-infected cells. However, the object of most transformations and transfections is to clone foreign DNA of interest into a known plasmid or viral vector and to isolate cells containing those recombinant molecules from each other and from those containing the non-recombinant vector. The E. coli lacZ operon has been incorporated into several cloning vectors, including plasmid pUC and bacteriophage M13. The polylinker regions of these vectors was engineered inside of the lacZ gene coding region, but in a way not to interrupt the reading frame or the functionality of the resultant lacZ gene protein product. This protein product is a galactosidase. In recombinant vectors which have an insert DNA molecule cloned into one of the restriction enzyme sites in the polylinker, this insert DNA results in an altered lacZ gene and a non-functional galactosidase. The presence or absence of this protein can easily be determined through the use of a simple chromogenic assay using IPTG and X-Gal. IPTG is the lacZ gene inducer and is necessary for the production of the galactosidase. The usual substrate for the lacZ gene protein product is galactose, which is metabolized into lactose and glucose. X-Gal is a colorless, modified galactose sugar. When this molecule is metabolized by the galactosidase, the resultant products are a bright blue color.

When IPTG and X-Gal are included in a plasmid DNA transformation, blue colonies represent bacteria harboring non-recombinant pUC vector DNA since the lacZ gene region is intact. IPTG induces production of the functional galactosidase which cleaves X-Gal and results in a blue colored metobolite. It follows that colorless colonies contain recombinant pUC DNA since a nonfunctional galactosidase is induced by IPTG which is unable to cleave the X-Gal. Similarly, for bacteriophage transfections, colorless plaques indicate regions of infection with recombinant M13 viruses, and blue plaques represent infection with non-recombinant M13.

Host Mutation Descriptions:

ara Inability to utilize arabinose.

deoR Regulatory gene that allows for constitutive synthesis for genes involved in deoxyribose synthesis. Allows for the uptake of large plasmids.

endA DNA specific endonuclease I. Mutation shown to improve yield and quality of DNA from plasmid minipreps.

F' F' episome, male E. coli host. Necessary for M13 infection.

galK Inability to utilize galactose.

galT Inability to utilize galactose.

gyrA Mutation in DNA gyrase. Confers resistance to nalidixic acid.

hfl High frequency of lysogeny. Mutation increases lambda lysogeny by inactivating specific protease.

lacI Repressor protein of lac operon. LacI[q] is a mutant lacI that overproduces the repressor protein.

lacY Lactose utilization; galactosidase permease (M protein).

lacZ b -D-galactosidase; lactose utilization. Cells with lacZ mutations produce white colonies in the presence of X-gal; wild type produce blue colonies.

lacZdM15 A specific N-terminal deletion which permits the a -complementation segment present on a phagemid or plasmid vector to make functional lacZ protein.