Chemistry of Minor Groove Binder–Oligonucleotide Conjugates
互联网
1683
- Abstract
- Table of Contents
- Figures
- Literature Cited
Abstract
Various types of minor groove binders have been attached to synthetic oligodeoxynucleotides, and the interactions of these conjugates (MB?ODNs) with DNA are reviewed here. MB?ODNs have enhanced DNA affinity and have improved the hybridization properties of sequence?specific DNA probes. Short MB?ODNs hybridize with ssDNA to give more stable DNA duplexes than unmodified ODNs with similar lengths. Mismatch discrimination of short MB?ODNs is enhanced in comparison to longer unmodified ODNs. The stronger binding of MB?ODNs allows for more stringent hybridization conditions to be used in DNA probe?based assays. MB?ODNs are especially useful in quantitative ?real?time? PCR assays since they bind efficiently during the high?temperature primer extension cycle. The synthesis and biophysical chemistry of MB?ODN conjugates are reviewed here. Four published structural classes of MB?ODNs and their various dsDNA binding modes are discussed, and the well?characterized DPI3 ?type MB?ODNs and their interactions with ssDNA target strands are described in detail.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online LibraryTable of Contents
- DNA Binding Modes and Structure of MB‐ODN Conjugates
- Synthesis and Hybridization of DPI3‐Type MB‐ODNs
- Hybridization Properties of DPI3‐ODNs
- Applications of DPI3‐ODNs in PCR Assays
- Summary
- Literature Cited
- Figures
- Tables
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online LibraryMaterials
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online LibraryFigures
-
Figure 8.4.1 Examples of minor groove binders (MBs). The planar, aromatic MB molecular structures are drawn in the presumed crescent shape conformation that binds to DNA duplexes. The inner (concave) edge of each MB faces the minor groove in B‐form DNA duplexes. Netropsin, distamycin, and imidazole‐lexitropsin are of the distamycin type; CC‐1065 is an alkylating CPI type; CDPI3 methyl ester is of the DPI type; Hoechst 33258 represents the Hoechst type; and ImPyPy‐γ‐PyPyPy‐Dp is of the dimer‐forming type. See text for a description of each type of MB. View Image -
Figure 8.4.2 Published examples of different types of MB‐ODN structures. Structures of the MB, the ODN, and the linker all affect hybridization performance. MB‐ODN conjugates were prepared by treating an ODN containing a linking group with a suitable reactive group on the MB. The different linker structures are described in the text. R, dabcyl chromophore. View Image -
Figure 8.4.3 DNA binding modes of MB‐ODNs. The drawings illustrate “unwound” DNA helices with 10‐mer MB‐ODNs. Mode 1 has the most predictable properties since the MB can only fold into a single dsDNA binding site after hybridization. The outer (convex) edge of the MB is shown as a black oval covering ∼5 bp in the minor groove. Longer linkers are required for the triplex binding modes since the ODN is bound in the major groove. View Image -
Figure 8.4.4 UV melting curves of DNA duplexes formed from distamycin‐type MB‐ODNs and their complements. First derivative plots of helix‐coil transitions at 260 nm for 3′‐MB‐ODN duplexes are shown. Distamycin‐type MBs of various lengths were prepared with zero to five MPC subunits and conjugated to dT8 or G/C‐rich 8‐mer ODNs. (A ) TTTTTTTT‐MPC n ( n = 0 to 5). (B ) CATCCGCT‐MPC n ( n =0,1,3,4,5). The A/T‐rich duplex shows a stepwise increase in duplex melting termperature ( T m ) with increasing MB length, whereas the G/C‐rich duplex shows no increase in stability. Reprinted from Sinyakov et al. () with permission from the American Chemical Society. View Image -
Figure 8.4.5 Synthesis methods for DPI3 ‐type MB‐ODNs. Method A involves acylation of amine‐modified ODNs using DPI3 ‐activated esters. Method B uses DPI3 ‐modified glass beads that allow rapid synthesis of MB‐ODNs with only slight modification of standard automated DNA synthesis methods. DPI3 ‐ODNs are easily purified by reversed‐phase HPLC methods. Both 5′‐ and 3′‐labeled conjugates can be synthesized from the same CPG reagent by using the appropriate 5′ or 3′ phosphoramidite nucleoside bases. CPG, controlled‐pore glass; DMSO, dimethyl sulfoxide; DMTr, 4,4′‐dimethoxytrityl. View Image -
Figure 8.4.6 Solution structure of the minor groove binding site in a DPI3 ‐ODN/DNA duplex was determined by NMR. The rendering above shows the 5′‐DPI3 , the linker structure, and the terminal T‐A base pair as solid bonds in a space‐filling DNA duplex. The DPI3 covers 5 to 6 bp in the minor groove. A 5′‐DPI3 ‐ODN with sequence 5′‐TGATTATCTG was made by method A (Fig. ) and hybridized to a complementary DNA strand. The DPI3 ‐ODN/DNA duplex had the same B‐form conformation as an unmodified 10‐mer DNA duplex (Kumar et al., ). The atomic coordinates for this structure were deposited in the Protein Data Bank as PDB ID: 1AUL. View Image -
Figure 8.4.7 Differential UV melting curves for complexes formed with DPI‐type MB‐ODNs. dT 8‐mers with the following 3′‐DPI n conjugate groups were melted with poly(dA) in 140 mM KCl, 10 mM MgCl2 , and 20 mM HEPES·HCl (pH 7.2). (1) no DPI, (2) DPI1 , (3) DPI2 , (4) DPI3 . The concentration of each ODN was 2 × 10–6 M and the A/T ratio was 1:1. Curve 5 shows the melting of the DPI2 conjugate alone in the same buffer. Anomalies in the melting curves may stem from self‐association and/or uncharaterized minor transitions. Reprinted from Lukhtanov et al. () with permission from the American Chemical Society. View Image -
Figure 8.4.8 Effect of A/T content on melting temperature ( T m ) of 3′‐modified DPI3 ‐ODNs versus unmodified 8‐mer ODNs is shown. Unmodified ODNs (light bars) show a linear decrease in T m as A/T content increases, while DPI3 ‐ODNs (dark bars) show only a slight drop in T m ( T m leveling effect). Sequences (5′ to 3′) of the 8‐mers are as follows: GCCGCCGC, GTCGCCGC, GTCGCTGC, GTCACTGT, GTTACTGT, GTTACTAT, GTTATTAT, ATTATTAT. The concentration of each ODN was 1 × 10–6 M, and the buffer used was 0.5× SSPE. View Image -
Figure 8.4.9 Relative free energy difference between match and mismatch. Detection of mismatches by a 3′‐modified 13‐mer DPI3 ‐ODN (light bars) and an unmodified 13‐mer ODN (dark bars) for various DNA targets. UV melting experiments were used to calculate a free energy difference (ΔΔ G °50 ) for each mismatch type and location. Mismatch discrimination for each duplex is shown in relationship to the DPI3 binding site. The sequence of the 13‐mer is TAAGTAGACATAA. View Image -
Figure 8.4.10 Typical assay formats for hybridization detection using fluorogenic DNA probes. F is a fluorescent reporter and Q is a nonfluorescent quencher. Quench release by nuclease digestion (TaqMan mechanism; Roche and Applied Biosystems) or hybridization (Eclipse mechanism; Epoch Biosystems) gives a fluorescent signal. The stylized MB‐ODN structure shows a coiled ODN conformation with MB, Q, and F in close contact. The two mechanisms are described in detail in Afonina et al. (). View Image -
Figure 8.4.11 Effect of 3′‐DPI3 on single‐base mismatch discrimination in the TaqMan assay. Fluorogenic 27‐mer and 12‐mer (3′‐DPI3 ) probes with similar T m were prepared (Kutyavin et al., ). The sequence of the 12‐mer probe was FAM‐GGCAATTTAAAGG×‐DPI3 and the sequence of the 27‐mer probe was FAM‐GGATACAAAGAATTGGGCAATTTAAAGGö, where FAM is fluorescein amidite and G× indicates the attachment point of a fluorescent quencher (TAMRA). Melting studies with mismatched complements showed improved discrimination with the shorter 3′‐DPID3 probe. Fluorogenic PCR was performed with an extension temperature of 60°C. Each diagram shows a real‐time PCR fluorescent curve with either match (upper curve) or mismatch (lower curve) plasmids as templates. View Image
Videos
Literature Cited
| Literature Cited | |
| Afonina, I., Kutyavin, I., Lukhtanov, E., Meyer, R.B., and Gamper, H. 1996. Sequence‐specific arrest of primer extension on single‐stranded DNA by an oligonucleotide‐minor groove binder conjugate. Proc. Natl. Acad. Sci. U.S.A. 93:3199‐3204. | |
| Afonina, I., Zivarts, M., Kutyavin, I., Lukhtanov, E., Gamper, H., and Meyer, R.B. 1997. Efficient priming of PCR with short oligonucleotides conjugated to a minor groove binder. Nucl. Acids Res. 25:2657‐2660. | |
| Afonina, I.A., Reed, M.W., Lusby, E., Shishkina, I.G., and Belousov, Y.S. 2002. Minor groove binder‐conjugated DNA probes for quantitative DNA detection by hybridization‐triggered fluorescence. BioTechniques 32:940‐949. | |
| Bailly, C. and Chaires, J.B. 1998. Sequence‐specific DNA minor groove binders. Design and synthesis of netropsin and distamycin analogues. Bioconjugate Chem. 9:513‐538. | |
| Baird, E.E. and Dervan, P.B. 1996. Solid phase synthesis of polyamides containing imidazole and pyrrole amino acids. J. Am. Chem. Soc. 118:6141‐6146. | |
| Boger, D.L. and Johnson, D.S. 1995. CC‐1065 and the duocarmycins: Unraveling the keys to a new class of naturally derived DNA alkylating agents. Proc. Natl. Acad. Sci. U.S.A. 92:3642‐3649. | |
| Boger, D.L. and Zhou, J. 1993. CDPI3‐enediyne and CDPI3‐EDTA conjugates: A new class of DNA cleaving agents. J. Org. Chem. 58:3018‐3024. | |
| Boger, D.L., Coleman, R.S., and Invergo, B.J. 1987. Studies on the total synthesis of CC‐1065: Preparation of a synthetic, simplified 3‐carbamoyl‐1,2‐dihydro‐3H‐pyrrolo[3,2‐e]indole dimer/trimer/tetramer (CDPI dimer/trimer/tetramer) and development of methodology for PDE‐I dimer methyl ester formation. J. Org. Chem. 52:1521‐1530. | |
| Boger, D.L., Invergo, B.J., Coleman, R.S., Zarrinmayeh, H., Kitos, P.A., Thompson, S.C., Leong, T., and McLaughlin, L.W. 1990. A demonstration of the intrinsic importance of stabilizing hydrophobic binding and non‐covalent van der waals contacts dominant in the non‐covalent CC‐1065/B‐DNA binding. Chem. Biol. Interact. 73:29‐52. | |
| Boger, D.L., Boyce, C.W., Garbaccio, R.M., and Goldberg, J.A. 1997. CC‐1065 and the duocarmycins: Synthetic studies. Chem. Rev. 97:787‐828. | |
| Chang, D.K. and Cheng, S.F. 1996. On the importance of van der Waals interaction in the groove binding of DNA with ligands: Restrained molecular dynamics study. Int. J. Biol. Macromol. 19:279‐285. | |
| Cory, M. 1995. DNA minor‐groove binding compounds as antitumor agents. Cancer Chemotherapeutic Agents: ACS Professions Reference Book Chapter 8:311‐344. | |
| de Kok, J.B., Wiegerinck, E.T., Giesendorf, B.A., and Swinkels, D.W. 2002. Rapid genotyping of single nucleotide polymorphisms using novel minor groove binding DNA oligonucleotides (MGB probes). Hum. Mutat. 19:554‐559. | |
| Dempcy, R.O., Kutyavin, I.V., Mills, A.G., Lukhtanov, E.A., and Meyer, R.B. 1999. Linkers designed to intercalate the double helix greatly facilitate DNA alkylation by triplex‐forming oligonucleotides carrying a cyclopropapyrroloindole reactive moiety. Nucl. Acids Res. 27:2931‐2937. | |
| Dickerson, R.E., Drew, H.R., Conner, B.N., Wing, R.M., Fratini, A.V., and Kopka, M.L. 1982. The anatomy of A‐, B‐, and Z‐DNA. Science 216:475‐485. | |
| Didenko, V.V. 2001. DNA probes using fluorescence resonance energy transfer (FRET): Designs and applications. Biotechniques 31:1106‐1121. | |
| Inga, A., Chen, F.X., Monti, P., Aprile, A., Campomenosi, P., Menichini, P., Ottaggio, L., Viaggi, S., Abbondandolo, A., Gold, B., and Fronza, G. 1999. N‐(2‐Chloroethyl)‐N‐nitrosourea tethered to lexitropsin induces minor groove lesions at the p53 cDNA that are more cytotoxic than mutagenic. Cancer Res. 59:689‐695. | |
| Johansson, M.K., Fidder, H., Dick, D., and Cook, R.M. 2002. Intramolecular dimers: A new strategy to fluorescence quenching in dual‐labeled oligonucleotide probes. J. Am. Chem. Soc. 124:6950‐6956. | |
| Kielkopf, C.L., White, S., Szewczyk, J.W., Turner, J.M., Baird, E.E., Dervan, P.B., and Rees, D.C. 1998. A structural basis for recognition of A‐T and T‐A base pairs in the minor groove of B‐DNA. Science 282:111‐115. | |
| Kim, D.‐Y., Shih, D.S., Cho, D.Y., and Swenson, D.H. 1995a. xHelix‐stabilizing compounds CC‐1065 and U‐71,184 bind to RNA‐DNA and DNA‐DNA duplexes containing modified internucleotide linkages and stabilize duplexes against thermal melting. Antisense Res. Dev. 5:49‐57. | |
| Kim, D.‐Y., Swenson, D.H., Cho, D.Y., Taylor, H.W., and Shih, D.S. 1995b. Helix‐stabilizing agent, CC‐1065, enhances suppression of translation by an antisense oligodeoxynucleotide. Antisense Res. Dev. 5:149‐154. | |
| Kumar, S., Reed, M.W., Gamper, H.B., Gorn, V.V., Lukhtanov, E.A., Foti, M., West, J., Meyer, R.B., and Schweitzer, B.I. 1998. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder. Nucl. Acids Res. 26:831‐838. | |
| Kutyavin, I.V., Lukhtanov, E.A., Gamper, H.B., and Meyer, R.B. 1997. Oligonucleotides with conjugated dihydropyrroloindole tripeptides: Base composition and backbone effects on hybridization. Nucl. Acids Res. 25:3718‐3723. | |
| Kutyavin, I.V., Afonina, I.A., Mills, A., Gorn, V.V., Lukhtanov, E.A., Belousov, E.S., Singer, M.J., Walburger, D.K., Lokhov, S.G., Gall, A.A., Dempcy, R., Reed, M.W., Meyer, R.B., and Hedgpeth, J. 2000. 3′‐Minor groove binder‐DNA probes increase sequence specificity at PCR extension temperatures. Nucl. Acids Res. 28:655‐661. | |
| Kutyavin, I.V., Lokhov, S.G., Afonina, I.A., Demp‐cy, R., Gall, A.A., Gorn, V.V., Lukhtanov, E., Metcalf, M., Mills, A., Reed, M.W., Sanders, S., Shishkina, I., and Vermeulen, N.M. 2002. Reduced aggregation and improved specificity of G‐rich oligodeoxyribonucleotides containing pyrazolo[3,4‐d]pyrimidine guanine bases. Nucl. Acids Res. 30:4952‐4959. | |
| Levina, A.S., Metelev, V.G., Cohen, A.S., and Zamecnik, P.C. 1996. Conjugates of minor groove DNA binders with oligonucleotides: Synthesis and properties. Antisense Nucleic Acid Drug Dev. 6:75‐85. | |
| Livak, K.J., Flood, S.J., Marmaro, J., Giusti, W., and Deetz, K. 1995. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 5:357‐362. | |
| Lukhtanov, E.A., Kutyavin, I.V., Gamper, H.B., and Meyer, R.B. Jr. 1995. Oligodeoxyribonucleotides with conjugated dihydropyrroloindole oligopeptides: Preparation and hybridization properties. Bioconjugate Chem. 6:418‐426. | |
| Lukhtanov, E.A., Kutyavin, I.V., and Meyer, R.B. 1996a. Direct, solid phase assembly of dihydropyrroloindole peptides with conjugated oligonucleotides. Bioconjugate Chem. 7:564‐567. | |
| Lukhtanov, E.A., Podyminogin, M.A., Kutyavin, I.V., Meyer, R.B., and Gamper, H.B. 1996b. Rapid and efficient hybridization‐triggered crosslinking within a DNA duplex by an oligodeoxyribonucleotide bearing a conjugated cyclopropapyrroloindole. Nucl. Acids Res. 24:683‐687. | |
| Lukhtanov, E.A., Kutyavin, I.V., Gorn, V.V., Reed, M.W., Adams, A.D., Lucas, D.D., and Meyer, R.B. Jr. 1997. Sequence and structure dependence of the hybridization‐triggered reaction of oligonucleotides bearing conjugated cyclopropapyrroloindole. J. Am. Chem. Soc. 119:6213‐6225. | |
| Lyamichev, V., Mast, A.L., Hall, J.G., Prudent, J.R., Kaiser, M.W., Takova, T., Kwiatkowski, R.W., Sander, T.J., de Arruda, M., Arco, D.A., Neri, B.P., and Brow, M.A. 1999. Polymorphism identification and quantitative detection of genomic DNA by invasive cleavage of oligonucleotide probes. Nature Biotechnol. 17:292‐296. | |
| Mikheikin, A.L., Zhuze, A.L., and Zasedatelev, A.S. 2001. Molecular modelling of ligand‐DNA minor groove binding: Role of ligand‐water interactions. J. Biomol. Struct. Dyn. 19:175‐178. | |
| Milesi, D., Kutyavin, I., Lukhtanov, E.A., Gorn, V.V., and Reed, M.W. 2000. Synthesis of oligonucleotide conjugates in anhydrous dimethyl sulfoxide. Methods Enzymol. 313:164‐173. | |
| Rajur, S.B., Robles, J., Wiederholt, K., Kuimelis, R.G., and McLaughlin, L.W. 1997. Hoechst 33258 tethered by a hexa(ethylene glycol) linker to the 5′‐termini of oligodeoxynucleotide 15‐mers: Duplex stabilization and fluorescence properties. J. Org. Chem. 62:523‐529. | |
| Robles, J. and McLaughlin, L.W. 1997. DNA triplex stabilization using a tethered minor groove binding Hoechst 33258 analogue. J. Am. Chem. Soc. 119:6014‐6021. | |
| Robles, J., Rajur, S.B., and McLaughlin, L.W. 1996. A parallel‐stranded DNA triplex tethering a Hoechst 363258 analogue results in complex stabilization by simultaneous major groove and minor groove binding. J. Am. Chem. Soc. 118:5820‐5821. | |
| Savage, H.F.J. 1993. Water structure. In Water and Biological Macromolecules (E. Westhof, ed.) pp. 3‐39. CRC Press, Boca Raton, Fla. | |
| Singh, M.P., Joseph, T., Kumar, S., Bathini, Y., and Lown, J.W. 1992. Synthesis and sequence‐specific DNA binding of a topoisomerase inhibitory analog of Hoechst 33258 designed for altered base and sequence recognition. Chem. Res. Toxicol. 5:597‐607. | |
| Sinyakov, A.G., Lokhov, S.G., Kutyavin, I.V., Gamper, H.B., and Meyer, R.B. 1995. Exceptional and selective stabilization of A‐T rich DNA‐DNA duplexes by N‐methypyrrole carboxamide peptides conjugated to oligodeoxynucleotides. J. Am. Chem. Soc. 117:4995‐4996. | |
| Szewczyk, J.W., Baird, E.E., and Dervan, P.B. 1996a. Cooperative triple‐helix formation via a minor groove dimerization domain. J. Am. Chem. Soc. 118:6778‐6779. | |
| Szewczyk, J.W., Baird, E.E., and Dervan, P.B. 1996b. Sequence‐specific recognition of DNA by a major and minor groove binding ligand. Angew. Chem. Int. Ed. Engl. 35:1487‐1489. | |
| Thuong, N. and Helene, C. 1993. Sequence‐specific recognition and modification of double‐helical DNA by olgionucleotides. Angew. Chem. 32:666‐690. | |
| Tyagi, S., Bratu, D.P., and Kramer, F.R. 1998. Multicolor molecular beacons for allele discrimination. Nature Biotechnol. 16:49‐53. | |
| Walker, N. 2002. A technique whose time has come. Science 296:557‐559. | |
| Wiederholt, K., Rajur, S.B., Giuliano, J. Jr., O'Donnell, M.J., and McLaughlin, L.W. 1996. DNA‐tethered Hoechst groove binding agents: Duplex stabilization and fluorescence characteristics. J. Am. Chem. Soc. 118: 7055‐7062. | |
| Wiederholt, K., Rajur, S.B., and McLaughlin, L.W. 1997. Oligonucleotides tethering Hoechst 33258 derivatives: Effect of the conjugation site on duplex stabilization and fluorescence properties. Bioconjugate Chem. 8:119‐126. | |
| Zimmer, C. and Wahnert, U. 1986. Nonintercalating DNA‐binding ligands: Specificity of the interaction and their use as tools in biophysical, biochemical and biological investigations of the genetic material. Prog. Biophys. Mol. Biol. 47:31‐112. |
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library
