Overview of Formation of G‐Quadruplex Structures
互联网
- Abstract
- Table of Contents
- Figures
- Literature Cited
Abstract
There are many structures that can be adopted by nucleic acids other than the Watson?Crick duplex. In particular, a noncanonical four?stranded topology, called a G?quadruplex, is of great interest because of its roles in key biological processes such as the maintenance of telomeres and regulation of gene transcription. This review describes the condition for forming the G?quadruplex structure, G?quadruplex?forming sequences, and methods for studying the structures. Curr. Protoc. Nucleic Acid Chem. 40:17.2.1?17.2.17. © 2010 by John Wiley & Sons, Inc.
Keywords: DNA structure; quadruplex?forming sequences; methods; conditions
Table of Contents
- Introduction
- Conditions for Forming the G‐Quadruplex Structure
- Methods for Studying G‐Quadruplex Structures
- G‐Quadruplex‐Forming Sequences
- Conclusion and Future Directions
- Acknowledgements
- Literature Cited
- Figures
Materials
Figures
-
Figure 17.2.1 (A ) Formation of a G‐tetrad. (B ) Anti (left) and syn (right) guanine conformations. (C ) Orientations of G‐strands. (i) All strands in the same direction. (ii) Three strands in one direction, and the fourth in the opposite direction. (iii) Two neighboring strands oriented in one direction, and the other two in the opposite direction. (iv) Each strand antiparallel to adjacent neighbors. Blue and red boxes represent guanine bases in the anti and syn conformations, respectively. (D ) Three kinds of loops connect the G‐tetrad. View Image -
Figure 17.2.2 Various types of modifications studied in on quadruplex formation. Chemical formulas of (A ) 6‐Methylguanine, (B ) Inosine, (C ) 6‐Thioguanine, (D ) 8‐Aminoguanine, (E ) 8‐Methylguanine, (F ) 8‐Bromoguanine, and (G ) 7,8‐dihydro‐8‐oxoguanine. Schematic representations of the G‐quadruplex structures containing a (H ) 3′‐3′ or (I ) 5′‐5′ inversion of polarity in d(TGGGGT) and (J ) bunch‐[d(TG4 T)]4 . Conformations of (K ) DNA, (L ) RNA, and (M ) LNA. View Image -
Figure 17.2.3 Folding topology of the human telomeric G‐quadruplex formed by (A ) d[AG3 (T2 AG3 )3 ] in Na+ solution, (B ) d[AG3 (T2 AG3 )3 ] in K+ crystal structure, (C ) d[TAG3 (T2 AG3 )3 ] in K+ solution, (D ) d[TA G3 (T2 AG3 )3 TT] in K+ solution and (E ) d[G3 (T2 AG3 )3 T] in K+ solution. Folding topology of the unimolecular G‐quadruplex structures of (F ) d(TGAGGGTGGGTAGGGTGGGTAA) in the c‐Myc promoter sequence, (G ) d(AGGGAGGGCGCTGGGAGGAGGG) in the c‐kit promoter sequence and (H ) d(GGGCGCGGGAGGAATTGGGCGGG) in the Bcl‐2 promoter sequence. View Image
Videos
Literature Cited
Literature Cited | |
Ambrus, A., Chen, D., Dai, J., Bialis, T., Jones, R.A., and Yang, D. 2006. Human telomeric sequence forms a hybrid‐type intramolecular G‐quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 34: 2723‐2735. | |
Armond, D.R., Wood, S., Sun, D., Hurley, L.H. and Ebbinghaus, S.W. 2005. Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the hypoxia inducible factor 1alpha promoter. Biochemistry 44: 16341‐16350. | |
Arnal‐Hérault, C., Banu, A., Barboiu, M., Michau, M., and van der Lee, A. 2007. Amplification and transcription of the dynamic supramolecular chirality of the guanine quadruplex. Angew. Chem. Int. Ed. 46: 4268‐4272. | |
Azzalin, C.M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. 2007. Telomeric repeat‐containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 318: 798‐801. | |
Bang, I. 1910. Untersuchungen über die Guanylsäure. Biochem. Z. 26: 293‐311. | |
Bates, P.J., Mergny, J.L., and Yang, D. 2007. Quartets in G‐major – The first international meeting on quadruplex DNA. EMBO Rep. 8: 1003‐1010. | |
Bates, P.J., Laber, D.A., Miller, D.M., Thomas, S.D., and Trent, J.O. 2009. Discovery and development of the G‐rich oligonucleotide AS1411 as a novel treatment for cancer. Exp. Mol. Pathol. 86: 151‐164. | |
Blume, S.W., Guarcello, V., Zacharias, W., and Miller, D.M. 1997. Divalent transition metal cations counteract potassium‐induced quadruplex assembly of oligo(dG) sequences. Nucleic Acids Res. 25: 617‐625. | |
Bonifacio, L., Church, F.C., and Jarstfer, M.B. 2008. Effect of locked‐nucleic acid on a biologically active G‐quadruplex. A structure‐activity relationship of the thrombin aptamer. Int. J. Mol. Sci. 9: 422‐433. | |
Bryan, T.M., Englezou, A., Gupta, J., Bacchetti, S., and Reddel, R.R. 1995. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J. 14: 4240‐4248. | |
Campbell, N.H. and Parkinson, G.N. 2007. Crystallographic studies of quadruplex nucleic acids. Methods 43: 252‐263. | |
Chang, C.C., Wu, J.Y., Chien, C.W., Wei‐Sung Wu, W.S., Liu, H., Kang, C.C., Yu, L.J., and Chang, T.C. 2003. A fluorescent carbazole derivative: High sensitivity for quadruplex DNA. Anal. Chem. 75: 6177‐6183. | |
Chang, C.C., Chu, J.F., Kao, F.J., Chiu, Y.C., Lou, P.J., Chen, H.C., and Chang, T.C. 2006. Verification of antiparallel G‐quadruplex structure in human telomeres by using two‐photon excitation fluorescence lifetime imaging microscopy of the 3,6‐bis(1‐methyl‐4‐vinylpyridinium)carbazole diiodide molecule. Anal. Chem. 78: 2810‐2815. | |
Chao, D.T. and Korsmeyer, S.J. 1998. BCL‐2 FAMILY: Regulators of cell death. Annu. Rev. Immunol. 16: 395‐419. | |
Chen, F.M. 1992. Sr2+ Facilitates intermolecular G‐quadruplex formation of telomeric sequences. Biochemistry 31: 3769‐3776. | |
Cogoi, S. and Xodo, L.E. 2006. G‐quadruplex formation within the promoter of the KRAS proto‐oncogene and its effect on transcription. Nucleic Acids Res. 34: 2536‐2549. | |
Creze, C., Rinaldi, B., Haser, R., Bouvet, P., and Gouet, P. 2007. Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li+ ions. Acta Cryst. D63: 682‐688. | |
Dai, J., Dexheimer, T.S., Chen, D., Carver, M., Ambrus, A., Jones, R.A., and Yang, D. 2006. An intramolecular G‐quadruplex structure with mixed parallel/antiparallel G‐strands formed in the human BCL‐2 promoter region in solution. J. Am. Chem. Soc. 128: 1096‐1098. | |
Dai, J., Carver, M., Punchihewa, C., Jones, R.A., and Yang, D. 2007. Structure of the Hybrid‐2 type intramolecular human telomeric G‐quadruplex in K+ solution: Insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Res. 35: 4927‐4940. | |
Dapić, V., Abdomerović, V., Marrington, R., Peberdy, J., Rodger, A., Trent, J.O., and Bates, P.J. 2003. Biophysical and biological properties of quadruplex oligodeoxyribonucleotides. Nucleic Acids Res. 31: 2097‐2107. | |
Esposito, V., Randazzo, A., Piccialli, G., Petraccone, L., Giancola, C., and Mayol, L. 2004. Effects of an 8‐bromodeoxyguanosine incorporation on the parallel quadruplex structure [d(TGGGT)]4. Org. Biomol. Chem. 2: 313‐318. | |
Esposito, V., Virgilio, A., Randazzo, A., Galeone, A., and Mayol, L. 2005. A new class of DNA quadruplexes formed by oligodeoxyribonucleotides containing a 3′‐3′ or 5′‐5′ inversion of polarity site. Chem. Commun. 31: 3953‐3955. | |
Gabelica, V., Rosu, F., Pauw, E.D., Lemaire, J., Gillet, J.C., Poully, J.C., Lecomte, F., Grégoire, G., Schermann, J.P., and Desfraçnois, C. 2008. Infrared signature of DNA G‐quadruplexes in the gas phase. J. Am. Chem. Soc. 130: 1810‐1811. | |
Gaynutdinov, T.I., Neumann, R., and Panyutin, I.G. 2008. Structural polymorphism of intramolecular quadruplex of human telomeric DNA: Effect of cations, quadruplex‐binding drugs and flanking sequences. Nucleic Acids Res. 36: 4079‐4087. | |
Gellert, M., Lipsett, M.N., and Davies, D.R. 1962. Helix formation by guanylic acid. Proc. Natl. Acad. Sci. U.S.A. 48: 2013‐2018. | |
Gill, M.L., Strobel, S.A., and Loria, J.P. 2005. 205Tl NMR methods for the characterization of monovalent cation binding to nucleic acids. J. Am. Chem. Soc. 127: 16723‐16732. | |
Gray, D.M., Wen, J.D., Gray, C.W., Repges, R., Repges, C., Raabe, G., and Fleischhauer, J. 2008. Measured and calculated CD Spectra of G‐quartets stacked with the same or opposite polarities. Chirality 20: 431‐440. | |
Gros, J., Rosu, F., Amrane, S., Cian, A.D., Gabelica, V., Lacroix, L., and Mergny, J.L. 2007. Guanines are a quartet's best friend: Impact of base substitutions on the kinetics and stability of tetramolecular quadruplexes. Nucleic Acids Res. 35: 3064‐3075. | |
Gros, J., Aviñó, A., Lopez de la Osa, J., González, C., Lacroix, L., Pérez, A., Orozco, M., Eritja, R., and Mergny, J.L. 2008. 8‐Amino guanine accelerates tetramolecular G‐quadruplex formation. Chem. Commun. 25: 2926‐2928. | |
Guo, K., Pourpak, A., Beetz‐Rogers, K., Gokhale, V., Sun, D., and Hurley, L.H. 2007. Formation of pseudosymmetrical G‐quadruplex and i‐motif structures in the proximal promoter region of the RET oncogene. J. Am. Chem. Soc. 129: 10220‐10228. | |
Haider, S., Parkinson, G.N., and Neidle, S. 2008. Molecular dynamics and principal components analysis of human telomeric quadruplex multimers. Biophys. J. 95: 296‐311. | |
Harley, C.B., Futcher, A.B., and Greider, C.W. 1990. Telomeres shorten during ageing of human fibroblasts. Nature 345: 458‐460. | |
Haq, I., Chowdhry, B.Z., and Jenkins, T.C. 2001. Calorimetric techniques in the study of high‐order DNA‐drug interactions. Methods Enzymol. 340: 109‐149. | |
Hellman, L.M., Rodgers, D.W., and Fried, M.G. 2009. Phenomenological partial‐specific volumes for G‐quadruplex DNAs. Eur Biophys J. 39:389‐396. | |
Hong, Y., Haubler, M., Lam, J.W.Y., Li, Z., Sin, K.K., Dong, Y., Tong, H., Liu, J., Qin, A., Renneberg, R., and Tang, B.Z. 2008. Label‐free fluorescent probing of G‐quadruplex formation and real‐time monitoring of DNA folding by a quaternized tetraphenylethene salt with aggregation‐Induced emission characteristics. Chem. Eur. J. 14: 6428‐6437. | |
Huang, C.Z., Liao, Q.G., Gan, L.H., Guo, F.L., and Li, Y.F. 2007. Telomere DNA conformation change induced aggregation of gold nanoparticles as detected by plasmon resonance light scattering technique. Analytica Chimica Acta. 604: 165‐169. | |
Hud, N.V., Smith, F.W., Anet, F.A.L., and Feigon, J. 1996. The selectivity for K+ versus Na+ in DNA quadruplexes is dominated by relative free energies of hydration: A thermodynamic analysis by 1H NMR. Biochemistry 35: 15383‐15390. | |
Huppert, J.L. and Balasubramanian, S. 2005. Prevalence of quadruplexes in the human genome. Nucleic Acids Res. 33: 2908‐2916. | |
Jeniffer, A.K., Juli, F., and Todd, O.Y. 1996. Reconciliation of the X‐ray and NMR structures of the thrombin‐binding aptamer d(GGTTGGTGTGGTTGG) J. Mol. Biol. 256: 417‐422. | |
Kan, Z.Y., Lin, Y., Wang, F., Zhuang, X.Y., Zhao, Y., Pang, D.W., Hao, Y.H., and Tan, Z. 2007. G‐quadruplex formation in human telomeric (TTAGGG)4 sequence with complementary strand in close vicinity under molecularly crowded condition. Nucleic Acids Res. 35: 3646‐3653. | |
Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L., Coviello, G.M., Wright, W.E., Weinrich, S.L., and Shay, J.W. 1994. Specific association of human telomerase activity with immortal cells and cancer. Science 266: 2011‐2015. | |
Kimura, T., Kawai, K., Fujitsuka, M., and Majima, T. 2004. Fluorescence properties of 2‐aminopurine in human telomeric DNA. Chem. Commun. 12: 1438‐1439. | |
Kouvaraki, M.A., Shapiro, S.E., Perrier, N.D., Cote, G.J., Gagel, R.F., Hoff, A.O., Sherman, S.I., Lee, J.E., and Evans, D.B. 2005. RET proto‐oncogene: A review and update of genotype‐phenotype correlations in hereditary medullary thyroid cancer and associated endocrine tumors. Thyroid 15: 531‐544. | |
Kranenberg, O. 2005. The KRAS oncogene. Past, present, and future. Biochim. Biophys. Acta. 176: 81‐82. | |
Kumar, N. and Maiti, S. 2007. Role of locked nucleic acid modified complementary strand in quadruplex/Watson‐Crick duplex equilibrium. J. Phys. Chem. B 111: 12328‐12337. | |
Kumar, N., Basundra, R., and Maiti, S. 2009. Elevated polyamines induce c‐MYC overexpression by perturbing quadruplex‐WC duplex equilibrium. Nucleic Acids Res. 37: 3321‐3331. | |
Kwan, I.C.M., Mo, X., and Wu, G. 2007. Probing hydrogen bonding and ion‐carbonyl interactions by solid‐state 17O NMR spectroscopy: G‐ribbon and G‐quartet. J. Am. Chem. Soc. 129: 2398‐2407. | |
Lee, J.Y. and Kim, D.S. 2009. Dramatic effect of single‐base mutation on the conformational dynamics of human telomeric G‐quadruplex. Nucleic Acids Res. 37: 3625‐3634. | |
Lee, J.Y., Yoon, J., Kim, H.W., and Kim, D.S. 2008. Structural diversity and extreme stability of unimolecular oxytricha nova telomeric G‐quadruplex. Biochemistry. 47: 3389‐3396. | |
Li, J., Correia, J.J., Wang, L., Trent, J.O., and Chaires, J.B. 2005. Not so crystal clear: The structure of the human telomere G‐quadruplex in solution differs from that present in a crystal. Nucleic Acids Res. 33: 4649‐4659. | |
Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., and Phan, A.T. 2009. Structure of the human telomere in K+ solution: a stable basket‐type G‐quadruplex with only two G‐tetrad layers. J. Am. Chem. Soc. 131: 4301‐4309. | |
Louis, C.B., Linda, C.G., John, A.L., Eric, H.V., and John, J.T. 1992. Selection of single‐stranded DNA molecules that bind and inhibit human thrombin. Nature 355: 564‐566. | |
Luu, K.N., Phan, A.T., Kuryavyi, V., Lacroix, L., and Patel, D.J. 2006. Structure of the human telomere in K+ solution: An intramolecular (3 + 1) G‐quadruplex scaffold. J. Am. Chem. Soc. 128: 9963‐9970. | |
Lynch, S., Baker, H., Byker, S.G., Zhou, D., and Sinniah, K. 2009. Single molecule force spectroscopy on G‐quadruplex DNA. Chem. Eur. J. 15: 8113‐8116. | |
Marathias, V.M., Sawicki, M.J., and Bolton, P.H. 1999. 6‐Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation. Nucleic Acids Res. 27: 2860‐2867. | |
Marcu, K.B., Bossone, S.A., and Patel, A.J. 1992. Myc function and regulation. Annu. Rev. Biochem. 61: 809‐860. | |
Marsh, T.C., Vesenka, J., Henderson, E. 1995. A new DNA nanostructure, the G‐wire, imaged by scanning probe microscopy. Nucleic Acids Res. 23: 696‐700. | |
Martadinata, H. and Phan, A.T. 2009. Structure of propeller‐type parallel‐stranded RNA G‐quadruplexes, formed by human telomeric RNA sequences in K+ solution. J. Am. Chem. Soc. 131: 2570‐2578. | |
Martiny‐Baron, G. and Marme, D. 1995. VEGF‐mediated tumour angiogenesis: A new target for cancer therapy. Curr. Opin. Biotechnol. 6: 675‐680. | |
Masse, J.E., Bortmann, P., Dieckmann, T., and Feigon, J. 1998. Simple, efficient protocol for enzymatic synthesis of uniformly 13C, 15N‐labeled DNA for heteronuclear NMR studies. Nucleic Acids Res. 26: 2618‐2624. | |
Mathur, V., Verma, A., Maiti, S., and Chowdhury, S. 2004. Thermodynamics of itetraplex formation in the nuclease hypersensitive element of human c‐myc promoter. Biochem. Biophys. Res. Commun. 320: 1220‐1227. | |
Matsugami, A., Xu, Y., Noguchi, Y., Sugiyama, H., and Katahira, M. 2007. Structure of a human telomeric DNA sequence stabilized by 8‐bromoguanosine substitutions, as determined by NMR in a K+ solution. FEBS J. 274: 3545‐3556. | |
Mekmaysy, C.S., Petraccone, L., Garbett, N.C., Ragazzon, P.A., Gray, R., Trent, J.O., and Chaires, J.B. 2008. Effect of O6‐methylguanine on the stability of G‐quadruplex DNA. J. Am. Chem. Soc. 130: 67100‐67111. | |
Miura, T. and Thomas, G.J. Jr. 1994. Structural polymorphism of telomere DNA: Interquadruplex and duplex‐quadruplex conversions probed by raman spectroscopy. Biochemistry 33: 7848‐7856. | |
Miura, T. and Thomas, G.J. Jr. 1995. Structure and dynamics of interstrand guanine association in quadruplex telomeric DNA. Biochemistry 34: 9645‐9654. | |
Miyoshi, D., Nakao, A., Toda, T., and Sugimoto, N. 2001. Effect of divalent cations on antiparallel G‐quartet structure of d(G4T4G4). FEBS Lett. 496: 128‐133. | |
Miyoshi, D., Nakao, A., and Sugimoto, N. 2002. Molecular crowding regulates the structural switch of the DNA G‐quadruplex. Biochemistry 41: 15017‐15024. | |
Nagatoishi, S., Nojima, T., Juskowiak, B., and Takenaka, S. 2005. A pyrene‐labeled G‐quadruplex oligonucleotide as a fluorescent probe for potassium ion detection in biological applications. Angew. Chem. Int. Ed. 44: 5067‐5070. | |
Neidle, S. 2009. The structures of quadruplex nucleic acids and their drug complexes. Curr. Opin. Struct. Biol. 19: 239‐250. | |
Nguyen, B., Tanious, F.A., Wilson, W.D. 2007. Biosensor‐surface plasmon resonance: Quantitative analysis of small molecule‐nucleic acid interactions. Methods 42: 150‐161. | |
Oliviero, G., Borbone, N., Galeone, A., Michela Varra, M., Picciallib, G., and Mayol, L. 2004. Synthesis and characterization of a bunchy oligonucleotide forming a monomolecular parallel quadruplex structure in solution. Tetrahedron Lett. 45: 4869‐4872. | |
Parkinson, G.N., Lee, M., and Neidle, S. 2002. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature 417: 876‐880. | |
Pelengaris, S., Rudolph, B., and Littlewood, T. 2000. Action of Myc in vivo proliferation and apoptosis. Curr. Opin. Genet. Dev. 10: 100‐105. | |
Petraccone, L., Trent, J.O., and Chaires, J.B. 2008. The tail of the telomere. J. Am. Chem. Soc. 130: 16530‐16532. | |
Petrovic, A.G. and Polavarapu, P.L. 2008a. Quadruplex structure of polyriboinosinic acid: Dependence on alkali metal ion concentration, pH and temperature. J. Phys. Chem. B 112: 2255‐2260. | |
Petrovic, A.G. and Polavarapu, P.L. 2008b. The quadruplex‐duplex structural transition of polyriboguanylic acid. J. Phys. Chem. B 112: 2245‐2254. | |
Phan, A.T. and Patel, D.J. 2002. Differentiation between unlabeled and very‐low‐level fully 15N, 13C‐labeled nucleotides for resonance assignments in nucleic acids. J. Biomol. NMR 23: 257‐262. | |
Phan, A.T., Kuryavyi, V., Luu, K.N., and Patel, D.J. 2007a. Structure of two intramolecular G‐quadruplexes formed by natural human telomere sequences in K+ solution. 2007a. Nucleic Acids Res. 35: 6517‐6525. | |
Phan, A.T., Kuryavyi, V., Burge, S., Neidle, S., and Patel, D.J. 2007b. Structure of an unprecedented G‐quadruplex scaffold in the human c‐kit promoter. J. Am. Chem. Soc. 129: 4386‐4392. | |
Qi, J. and Shafer, R.H. 2007. Human telomere quadruplex: Refolding and selection of individual conformers via RNA/DNA chimeric editing. Biochemistry 46: 7599‐7606. | |
Qin, Y., Rezler, E.M., Gokhale, V., Sun, D., and Hurley, L.H. 2007. Characterization of the G‐quadruplexes in the duplex nuclease hypersensitive element of the PDGF‐A promoter and modulation of PDGF‐A promoter activity by TMPyP4. Nucleic Acids Res. 25: 7698‐7713. | |
Rachwal, P.A. and Fox, K.R. 2007. Quadruplex melting. Methods 43: 291‐301. | |
Sakurai, S., Fukasawa, T., Chong, J.M., Tanaka, A., and Fukayama, M. 1999. C‐kit gene abnormalities in gastrointestinal stromal tumors (tumors of interstitial cells of Cajal). Jpn. J. Cancer Res. 90: 1321‐1328. | |
Schaffitzel, C., Berger, I., Postberg, J., Hanes, J., Lipps, H.J., and Plückthun, A. 2001. In vitro generated antibodies specific for telomeric guanine‐quadruplex DNA react with Stylonychia lemnae macronuclei. Proc. Natl. Acad. Sci. U.S.A. 98: 8572‐8577. | |
Schoeftner, S. and Blasco, M.A. 2008. Developmentally regulated transcription of mammalian telomeres by DNA‐dependent RNA polymerase II. Nat. Cell Biol. 10: 228‐236. | |
Schonhoft. J.D., Bajracharya, R., Dhakal, S., Yu, Z., Mao, H., and Basu, S. 2009. Direct experimental evidence for quadruplex‐quadruplex interaction within the human ILPR. Nucleic Acids Res. 37: 3310‐3320. | |
Seo, Y.J., Lee, I.J., Yi, J.W., and Kim, B.H. 2007. Probing the stable G‐quadruplex transition using quencher‐free endstacking ethynyl pyrene‐adenosine. Chem. Commun. 27: 2817‐2819. | |
Shirude, P.S., Ying, L., and Balasubramanian, S. 2008. Single molecule conformational analysis of the biologically relevant DNA G‐quadruplex in the promoter of the proto‐oncogene c‐MYC. Chem. Commun. 17: 2007‐2009. | |
Simonsson, T. and Sjöback, R. 1999. DNA tetraplex formation studied with fluorescence resonance energy transfer. J. Biol. Chem. 274: 17379‐17383. | |
Smirnov, I. and Shafer, R.H. 2000. Lead is unusually effective in sequence‐specific folding of DNA. J. Mol. Biol. 296: 1‐5. | |
Smith, F.W. and Feigon, J. 1992. Quadruplex structure of Oxytricha telomeric DNA oligonucleotides. Nature 356: 164‐168. | |
Špačovà, N., Cubero, E., Šponer,, J., and Orozco, M. 2004. Theoretical study of the Guanine→6‐thioguanine substitution in duplexes, triplexes, and tetraplexes. J. Am. Chem. Soc. 126: 14642‐14650. | |
Šponer, J. and Špačková, N. 2007. Molecular dynamics simulations and their application to four‐stranded DNA. Methods 43: 278‐290. | |
Stegle, O., Payet, L., Mergny, J.L., MacKay, D.J.C., and Huppert, J.L. 2009. Predicting and understanding the stability of G‐quadruplexes. Bioinformatics 25: i374‐i382. | |
Sun, D., Guo, K., Rusche, J.J., and Hurley, L.H. 2005. Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G‐quadruplex‐interactive agents. Nucleic Acids Res. 33: 6070‐6080. | |
Szalai, V.A., Singer, M.J., and Thorp, H.H. 2002. Site‐specific probing of oxidative reactivity and telomerase function using 7,8‐dihydro‐8‐oxoguanine in telomeric DNA. J. Am. Chem. Soc. 124: 1625‐1631. | |
Tang, C.F. and Shafer, R.H. 2006. Engineering the quadruplex fold: nucleoside conformation determines both folding topology and molecularity in guanine quadruplexes. J. Am. Chem. Soc. 128: 5966‐5973. | |
Tao, L., Lili, S., Erkang, W., and Shaojun, D. 2009. Multifunctional G‐quadruplex aptamers and their application to protein detection. Chem. Eur. J. 15: 1036‐1042. | |
Todd, A.K. 2007. Bioinformatics approaches to quadruplex sequence location. Methods 43: 246‐251. | |
Todd, A.K., Johnston, M., and Neidle, S. 2005. Highly prevalent putative quadruplex sequence motifs in human DNA. Nucleic Acids Res. 33: 2901‐2907. | |
Travascio, P., Li, Y., and Sen, D. 1998. DNA‐enhanced peroxidase activity of a DNA aptamer‐hemin complex. Chem. Biol. 5: 505‐517. | |
Virgilio, A., Esposito, V., Randazzo, A., Mayol, L., and Galeone, A. 2005. 8‐Methyl‐2′‐deoxyguanosine incorporation into parallel DNA quadruplex structures. Nucleic Acids Res. 33: 6188‐6195. | |
Vo, T.U. and McGown, L.B. 2004. Selectivity of quadruplex DNA stationary phases toward amino acids in homodipeptides and alanyl dipeptides. Electrophoresis 25: 1230‐1236. | |
Wang, Y. and Patel, D.J. 1993. Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G‐tetraplex. Structure 1: 263‐282. | |
Wang, Y. and Patel, D.J. 1994. Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G‐tetraplex. Structure 2: 1141‐1156. | |
Weitzmann, M.N., Woodford, K.J., and Usdin, K. 1996. The development and use of a DNA polymerase arrest assay for the evaluation of parameters affecting intrastrand tetraplex formation. J. Biol. Chem. 271: 20958‐20964. | |
Wilson, W.D. and Sugiyama H. 2007. First international meeting on quadruplex DNA. ACS Chem. Biol. 2: 589‐594. | |
Wong, A., Ida, R., and Wu, G. 2005. Direct NMR detection of the “invisible” alkali metal cations tightly bound to G‐quadruplex structures. BBRC 337: 363‐366. | |
Xiaohong, C., Xiangjun, L., Tao, B., Zehui, C., and Dihua, S. 2009. General peroxidase activity of G‐quadruplex‐hemin complexes and its application in ligand screening. Biochemistry 48: 7817‐7823. | |
Xu, Y., Noguchi, Y., and Sugiyama, H. 2006. The new models of the human telomere d[AGGG(TTAGGG)3] in K+ solution. Bioorg. Med. Chem. 14: 5584‐5591. | |
Xu, Y., Kaminaga, K., and Komiyama, M. 2008. G‐quadruplex formation by human telomeric repeats‐containing RNA in Na+ solution. J. Am. Chem. Soc. 130: 11179‐11184. | |
Xu, Y., Suzuki, Y., and Komiyama, M. 2009. Click chemistry for the identification of G‐quadruplex structures: Discovery of a DNA‐RNA G‐quadruplex. Angew. Chem. Int. Ed. 48: 3281‐3284. | |
Xue, Y., Kan, Z.Y., Wang, Q., Yao, Y., Liu, J., Hao, Y.H., and Tan, Z. 2007. Human telomeric DNA forms parallel‐stranded intramolecular G‐Quadruplex in K+ solution under molecular crowding condition. J. Am. Chem. Soc. 129: 11185‐11191. | |
Yin, F., Liub, J., and Penga, X. 2003. Triethylene tetraamine: A novel telomerase inhibitor. Bioorg. Med. Chem. Lett. 13: 3923‐3926. | |
Ying, L., Green, J.J., Li, H., Klenerman, D., and Balasubramanian, S. 2003. Studies on the structure and dynamics of the human telomeric G quadruplex by single‐molecule fluorescence resonance energy transfer. PNAS 100: 14629‐14634. | |
Yu, H.Q., Miyoshi, D., and Sugimoto, N. 2006. Characterization of structure and stability of long telomeric DNA G‐quadruplexes. J. Am. Chem. Soc. 128: 15461‐15468. | |
Yu, J., Ustach, C., and Kim, H.R. 2003. Platelet‐derived growth factor signaling and human cancer. J. Biochem. Mol. Biol. 36: 49‐59. | |
Yu, Z., Schonhoft, J.D., Dhakal, S., Bajracharya, R., Hegde, R., Basu, S., and Mao, H. 2009. ILPR G‐quadruplexes formed in seconds demonstrate high mechanical stabilities. J. Am. Chem. Soc. 131: 1876‐1882. | |
Zahler, A.M., Williamson, J.R., Cech, T.R., and Prescott, D.M. 1991. Inhibition of telomerase by G‐quartet DNA structures. Nature 350: 718‐720. | |
Zeng, Z.X., Zhao, Y., Hao, Y.H., and Tan, Z. 2005. Tetraplex formation of surface‐immobilized human telomere sequence probed by surface plasmon resonance using single‐stranded DNA binding protein. J. Mol. Recognit. 18: 267‐271. | |
Zhong, H., De Marzo, A.M., Laughner, E., Lim, M., Hilton, D.A., Zagzag, D., Buechler, P., Isaacs, W.B., and Semenza, G.L. 1999. Overexpression of hypoxia‐inducible factor 1alpha in common human cancers and their metastases. Cancer Res. 59: 5830‐5835. | |
Zhou, J., Wei, C., Jia, G., Wang, X., Tang, Q., Feng, Z., and Li, C. 2008. The structural transition and compaction of human telomeric G‐quadruplex induced by excluded volume effect under cation‐deficient conditions. Biophys. Chem. 136: 124‐127. | |
Zhuang, X.Y., Tang, J., Hao, Y.H., and Tan, Z. 2007. Fast detection of quadruplex structure in DNA by the intrinsic fluorescence of a single‐stranded DNA binding protein. J. Mol. Recognit. 20: 386‐391. |