Engineering Customized TALE Nucleases (TALENs) and TALE Transcription Factors by Fast Ligation‐Based Automatable Solid‐Phase High‐Throughput (FLASH) A

互联网2013-12-31

1047

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

Customized DNA?binding domains made using transcription activator?like effector (TALE) repeats are rapidly growing in importance as widely applicable research tools. TALE nucleases (TALENs), composed of an engineered array of TALE repeats fused to the FokI nuclease domain, have been used successfully for directed genome editing in various organisms and cell types. TALE transcription factors (TALE?TFs), consisting of engineered TALE repeat arrays linked to a transcriptional regulatory domain, have been used to up? or downregulate expression of endogenous genes in human cells and plants. This unit describes a detailed protocol for the recently described fast ligation?based automatable solid?phase high?throughput (FLASH) assembly method. FLASH enables automated high?throughput construction of engineered TALE repeats using an automated liquid handling robot or manually using a multichannel pipet. Using the automated approach, a single researcher can construct up to 96 DNA fragments encoding TALE repeat arrays of various lengths in a single day, and then clone these to construct sequence?verified TALEN or TALE?TF expression plasmids in a week or less. Plasmids required for FLASH are available by request from the Joung lab (http://eGenome.org). This unit also describes improvements to the Zinc Finger and TALE Targeter (ZiFiT Targeter) web server (http://ZiFiT.partners.org) that facilitate the design and construction of FLASH TALE repeat arrays in high throughput. Curr. Protoc. Mol. Biol. 103:12.16.1?12.16.18. © 2013 by John Wiley & Sons, Inc.

Keywords: FLASH; TALEN; TALE; TAL effector; TALE activator

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: Identification of Target Sites Using ZiFiT Targeter Software
Basic Protocol 2: Flash Assembly of DNA Encoding TALE Repeat Arrays
Support Protocol 1: Preparation of the α Unit
Support Protocol 2: Preparation of Extension and Termination Units
Basic Protocol 3: Cloning and Sequence Verification of TALEN or TALE‐TF Expression Vectors
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Identification of Target Sites Using ZiFiT Targeter Software

Materials

ZiFiT web‐based software (http://ZiFiT.partners.org)
Repeat Masker web‐based software (http://www.repeatmasker.org)
Genomic sequence of locus to be targeted
Computer with internet browser and internet connection

Basic Protocol 2: Flash Assembly of DNA Encoding TALE Repeat Arrays

Materials

Digested FLASH reagents:
- α unit (see protocol 3 )
- Extension unit (encoding two or four repeats; see protocol 4 )
- Termination unit (encoding one, two, or three TALE repeats; see protocol 4 )
2× quick ligation buffer (QLB; see recipe )
T4 DNA ligase (New England Biolabs, cat. no. M0202L)
20 U/µl Bsa I‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3535L)
5 U/µl Bbs I with 10× NEBuffer 2 (New England Biolabs, cat. no. R0539L)
DEPC‐treated water (see recipe )
Phosphorylated capping oligo (see recipe )
2× B&W buffer (see recipe )
1× bovine serum albumin (BSA): dilute 100× stock (10 mg/ml, New England Biolabs, cat. no. B9001S) in nuclease‐free DEPC‐treated water

SciClone G3 (Caliper) or comparable liquid handling system (for high throughput) or multichannel pipet (12‐channel, 20‐200 and 10‐100 µl; for medium throughput)
96‐well PCR plates
96‐well StrepMax streptavidin‐coated plates (Thermo Scientific, cat. no. AB‐1226)
Thermocycler
Orbital platform shaker with adjustable speed
MinElute PCR Purification Kit (Qiagen cat. no. 28006)
1.5‐ml microcentrifuge tubes

Support Protocol 1: Preparation of the α Unit

Materials

10 mM dNTPs (Roche, cat. no. 11969064001)
Plasmids encoding α units (available from Joung lab, http://eGenome.org)
Expand High‐Fidelity PCR System (Roche, cat. no. 11732641001)
10 pmol/µl biotinylated forward PCR primer oJS2581: 5′‐biotin‐TCTAGAGAAGACAAGAACCTGACC‐3′
10 pmol/µl reverse PCR primer oJS2582: 5′‐GGATCCGGTCTCTTAAGGCCGTGG‐3′
DEPC‐treated water (see recipe )
20 U/µl Bsa I‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3535L)

1.5‐ml PCR tubes
Thermocycler
QIAquick PCR Purification Kit (Qiagen, cat. no. 28106)

Additional reagents and equipment for quantifying microvolumes of DNA ( appendix 3D or )

Support Protocol 2: Preparation of Extension and Termination Units

Materials

Plasmids encoding extension and termination units (available from Joung lab, http://eGenome.org)
Bbs I with 10× NEBuffer 2 (New England Biolabs, cat. no. R0539L)
Bam HI‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3136L)
Xba I with 10× NEBuffer 4 (New England Biolabs, cat. no. R0145L)
Sal I‐HF with 10× NEBuffer 4 (New England Biolabs, cat. no. R3138L)
DEPC‐treated water (see recipe )
100× bovine serum albumin (BSA, 10 mg/ml, New England Biolabs, cat. no. B9001S)

1.5‐ml microcentrifuge tubes
Thermocycler
QIAquick PCR Purification Kit (Qiagen, cat. no. 28106)

Additional reagents and equipment for quantifying microvolumes of DNA ( appendix 3D or )

Basic Protocol 3: Cloning and Sequence Verification of TALEN or TALE‐TF Expression Vectors

Materials

TALEN and/or TALE activator expression vector (Addgene, see Table 12.16.1 )
Bsm BI with NEBuffer 3 (New England Biolabs, cat. no. R0580L)
DEPC‐treated water (see recipe )
Agencourt AMPure XP beads (Agencourt/Beckman Genomics, cat. no. A63881; for TALENs only)
Purified TALE repeat array constructs (see protocol 2 )
Quick ligation buffer (QLB, see recipe )
400 U/µl T4 DNA Ligase (New England Biolabs, cat. no. M0202L)
Chemically competent XL1‐Blue bacterial cells (recA1 endA1 gyrA96 thi‐1 hsdR17 supE44 relA1 lac [F′ proAB lacIq lacZDM15 Tn10 (TetR)]; Stratagene, cat no. 200249)
LB medium powder (Difco, cat. no. 244620)
LB agar medium powder (Difco, cat. no 244520)
Carbenicillin (Sigma, cat. no. C1389)
Phusion High‐Fidelity DNA polymerase (Phusion HF) with buffer (New England Biolabs, cat. no. M0530L)
10 mM dNTPs (Roche, cat. no. 11969064001)
Primers for colony PCR and sequencing (5 µM each):
- oSQT 34: 5′‐GACGGTGGCTGTCAAATACCAAGATATG‐3′
- oSQT 35: 5′‐TCTCCTCCAGTTCACTTTTGACTAGTTGGG‐3′
- oSQT1: 5′‐AGTAACAGCGGTAGAGGCAG‐3′
- oSQT3: 5′‐ATTGGGCTACGATGGACTCC‐3′
- oSQT38: 5′‐TTCGGGAATACGGCGATTG‐3′
- JDS2980: 5′‐TTAATTCAATATATTCATGAGGCAC‐3′
QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106)

1.5‐ml microcentrifuge tubes
Thermocycler

Additional reagents and equipment for agarose gel electrophoresis (unit 2.5 ), polyacrylamide gel electrophoresis (unit 2.7 ; optional for TALE‐activators only), and quantifying microvolumes of DNA ( appendix 3D or )

Table 2.6.1 MaterialsTALEN and TALE‐Activator Expression Vectors

0.5 domain in vector	p65 activation vector	VP64 activation vector	Nuclease vector
NI	pMLM2581	pMLM3367	pJDS70
HD	pMLM2583	pMLM3585	pJDS71
NN	pMLM2585	pMLM3587	pJDS74
NG	pMLM2579	pMLM3583	pJDS78

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 12.16.1 Schematic overview of FLASH assembly for a DNA fragment encoding 16 TALE repeats. A biotinylated repeat unit (α unit) is first ligated to a predigested extension unit (βγδɛ unit) in solution and then attached to a streptavidin‐coated plate. This fragment is uncapped by restriction digest and the second extension unit (βγδɛ unit) is ligated. This process is repeated to extend the fragment to a length of 16 repeat arrays. Finally, a termination unit (βγδ unit) is attached and the full‐length fragment is cleaved from the biotin, which remains immobilized. The fragment is column purified and cloned into an expression vector of choice.

View Image

Figure 12.16.2 Restriction map of a FLASH plasmid harboring an extension unit. In the example shown, the extension unit contains coding sequence for four TALE repeats (colored rectangles). Extension units are released from their plasmid vectors using a quadruple digest. Digestion with Bbs I and Bam HI releases the unit from the plasmid with appropriate overhangs for use in FLASH assembly. Digestion with Xba I and Sal I prevents the released unit fragment from religating back into the vector, eliminating the need to gel purify the fragment.

View Image

Videos

Literature Cited

	Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. 2009. Breaking the code of DNA binding specificity of TAL‐type III effectors. Science 326:1509‐1512.
	Bogdanove, A.J. and Voytas, D.F. 2011. TAL effectors: Customizable proteins for DNA targeting. Science 333:1843‐1846.
	Bultmann, S., Morbitzer, R., Schmidt, C.S., Thanisch, K., Spada, F., Elsaesser, J., Lahaye, T., and Leonhardt, H. 2012. Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers. Nucleic Acids Res. 40:5368‐5377.
	Cade, L., Reyon, D., Hwang, W.Y., Tsai, S.Q., Patel, S., Khayter, C., Joung, J.K., Sander, J.D., Peterson, R.T., and Yeh, J.R. 2012. Highly efficient generation of heritable zebrafish gene mutations using homo‐ and heterodimeric TALENs. Nucleic Acids Res. 40:8001‐8010.
	Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F. 2011. Efficient design and assembly of custom TALEN and other TAL effector‐based constructs for DNA targeting. Nucleic Acids Res. 39:e82.
	Cong, L., Zhou, R., Kuo, Y.C., Cunniff, M., and Zhang, F. 2012. Comprehensive interrogation of natural TALE DNA‐binding modules and transcriptional repressor domains. Nat. Commun. 3:968.
	Garg, A., Lohmueller, J.J., Silver, P.A., and Armel, T.Z. 2012. Engineering synthetic TAL effectors with orthogonal target sites. Nucleic Acids Res. 40:7584‐7595.
	Geissler, R., Scholze, H., Hahn, S., Streubel, J., Bonas, U., Behrens, S.E., and Boch, J. 2011. Transcriptional activators of human genes with programmable DNA‐specificity. PLoS One 6:e19509.
	Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J., Zhang, L., Santiago, Y., Miller, J.C., Zeitler, B., Cherone, J.M., Meng, X., Hinkley, S.J., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Jaenisch, R. 2011. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29:731‐734.
	Joung, J.K. and Sander, J.D. 2013. TALENs: A widely applicable technology for targeted genome editing. Nat. Rev. Mol. Cell Biol. 14:49‐55.
	Kuntz, I.D., Chen, K., Sharp, K.A., and Kollman, P.A. 1999. The maximal affinity of ligands. Proc. Natl. Acad. Sci. U.S.A. 96:9997‐10002.
	Maeder, M.L., Linder, S.J., Reyon, D., Angstman, J.F., Fu, Y., Sander, J.D., and Joung, J.K. 2013. Robust, synergistic regulation of human gene expression using TALE activators. Nat. Methods 10:243‐245.
	Mahfouz, M.M., Li, L., Piatek, M., Fang, X., Mansour, H., Bangarusamy, D.K., and Zhu, J.K. 2012. Targeted transcriptional repression using a chimeric TALE‐SRDX repressor protein. Plant Mol. Biol. 78:311‐321.
	Miller, J.C., Tan, S., Qiao, G., Barlow, K.A., Wang, J., Xia, D.F., Meng, X., Paschon, D.E., Leung, E., Hinkley, S.J., Dulay, G.P., Hua, K.L., Ankoudinova, I., Cost, G.J., Urnov, F.D., Zhang, H.S., Holmes, M.C., Zhang, L., Gregory, P.D., and Rebar, E.J. 2011. A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 29:143‐148.
	Moore, F.E., Reyon, D., Sander, J.D., Martinez, S.A., Blackburn, J.S., Khayter, C., Ramirez, C.L., Joung, J.K., and Langenau, D.M. 2012. Improved somatic mutagenesis in zebrafish using transcription activator‐like effector nucleases (TALENs). PLoS One 7:e37877.
	Moscou, M.J. and Bogdanove, A.J. 2009. A simple cipher governs DNA recognition by TAL effectors. Science 326:1501.
	Perez‐Pinera, P., Ousterout, D.G., Brunger, J.M., Farin, A.M., Glass, K.A., Guilak, F., Crawford, G.E., Hartemink, A.J., and Gersbach, C.A. 2013. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nat. Methods 10:239‐242.
	Reyon, D., Tsai, S.Q., Khayter, C., Foden, J.A., Sander, J.D., and Joung, J.K. 2012. FLASH assembly of TALENs for high‐throughput genome editing. Nat. Biotechnol. 30:460‐465.
	Sander, J.D., Maeder, M.L., Reyon, D., Voytas, D.F., Joung, J.K., and Dobbs, D. 2010. ZiFiT (Zinc Finger Targeter): An updated zinc finger engineering tool. Nucleic Acids Res. 38:W462‐W468.
	Sander, J.D., Cade, L., Khayter, C., Reyon, D., Peterson, R.T., Joung, J.K., and Yeh, J.R. 2011. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat. Biotechnol. 29:697‐698.
	Scholze, H. and Boch, J. 2011. TAL effectors are remote controls for gene activation. Curr. Opin. Microbiol. 14:47‐53.
	Tesson, L., Usal, C., Menoret, S., Leung, E., Niles, B.J., Remy, S., Santiago, Y., Vincent, A.I., Meng, X., Zhang, L., Gregory, P.D., Anegon, I., and Cost, G.J. 2011. Knockout rats generated by embryo microinjection of TALENs. Nat. Biotechnol. 29:695‐696.
	Tremblay, J.P., Chapdelaine, P., Coulombe, Z., and Rousseau, J. 2012. TALE proteins induced the expression of the frataxin gene. Hum. Gene. Ther. 23:883‐890
	Wang, Z., Li, J., Huang, H., Wang, G., Jiang, M., Yin, S., Sun, C., Zhang, H., Zhuang, F., and Xi, J.J. 2012. An integrated chip for the high‐throughput synthesis of transcription activator‐like effectors. Angew Chem. Int. Ed. Engl. 51:8505‐8508.
	Wood, A.J., Lo, T.W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C., Leung, E., Meng, X., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Meyer, B.J. 2011. Targeted genome editing across species using ZFNs and TALENs. Science 333:307.
	Zhang, F., Cong, L., Lodato, S., Kosuri, S., Church, G.M., and Arlotta, P. 2011. Efficient construction of sequence‐specific TAL effectors for modulating mammalian transcription. Nat. Biotechnol. 29:149‐153.
Key Reference
	Reyon et al., 2012. See above.
	This paper describes the development and validation of FLASH for assembling TALE repeat arrays and the archive of 376 plasmids for the α units, extension units, and termination units needed to practice the method. It presents large‐scale studies demonstrating that FLASH‐assembled TALENs offer high activity, a robust success rate, and an essentially limitless targeting range in human cells.
Internet Resources
	http://ZiFiT.partners.org
	Provides access to ZiFiT software for engineering TALENs.
	http://www.addgene.org/talengineering
	TALEN and TALE‐activator expression vectors are available through Addgene.
	http://eGenome.org
	The archive of 376 plasmids required for FLASH are available by request from the Joung lab.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Engineering Customized TALE Nucleases (TALENs) and TALE Transcription Factors by Fast Ligation‐Based Automatable Solid‐Phase High‐Throughput (FLASH) A

Abstract

Table of Contents

Materials

Basic Protocol 1: Identification of Target Sites Using ZiFiT Targeter Software

Basic Protocol 2: Flash Assembly of DNA Encoding TALE Repeat Arrays

Support Protocol 1: Preparation of the α Unit

Support Protocol 2: Preparation of Extension and Termination Units

Basic Protocol 3: Cloning and Sequence Verification of TALEN or TALE‐TF Expression Vectors

Figures

Videos

Literature Cited