Generation of Spatio‐Temporally Controlled Targeted Somatic Mutations in the Mouse

互联网2013-12-31

1932

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

The generation of ligand?activated site?specific Cre recombinases has led to the development of cell type?specific temporally controlled targeted somatic mutagenesis in the mouse. We illustrate this technique using K14?Cre?ER^T2 transgenic mice that express the tamoxifen (tam)?activatable Cre?ER^T2 recombinase in epidermal basal keratinocytes to induce mutations in epidermal keratinocytes of adult mice. Our highly reproducible technique, based on induction of Cre?ER^T2 recombinase activity by tamoxifen administration at low doses (once daily 100?µg intraperitoneal injection for 5 days), has allowed the generation of site?directed somatic mutations of numerous genes in mouse epidermal keratinocytes, and several mouse models of human diseases. The present step?by?step protocol describes how to introduce temporally controlled targeted mutations in epidermal keratinocytes of adult mice. Curr. Protoc. Mouse Biol. 1:55?70. © 2011 by John Wiley & Sons, Inc.

Keywords: Cre?ERT2; tamoxifen; loxP; keratinocytes; skin

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Strategic Planning
Basic Protocol 1: Generation of Temporally Controlled Mutations in Skin Using Mice Expressing Cre‐ERT2 Selectively in Keratinocytes
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Generation of Temporally Controlled Mutations in Skin Using Mice Expressing Cre‐ERT2 Selectively in Keratinocytes

Materials

K14‐Cre‐ER^T2 mice (Indra et al., ; Li et al., ; US patent no.7112715 and European patent no.1 692 936 cover commercial use of Cre‐ER^T2 expressing mice)
GeneX^L2/+ or GeneX^L2/L2 mice, which bear one or two floxed target alleles
Custom‐designed oligo primers (see Table 10.1.2800 and Figs. and ; also see recipe )
Direct PCR lysis solution (see recipe )
Cre PCR master mix (see Table 10.1.2800 )
GeneX PCR master mix (see Table 10.1.2800 )
Ethidium bromide–stained 2.0% agarose gel in TBE electrophoresis buffer (see recipe ) (Armstrong and Schulz, )
DNA Ladder Gene Ruler (Euromedex, cat. no. SM0331)
Tamoxifen ( see recipe )
Isoflurane
70% (v/v) ethanol
Dispase solution (see recipe )
Proteinase K digestion buffer (see recipe )
Ethanol (EtOH)
Sterile water
Tris⋅Cl, pH 8.0
1:1 phenol:chloroform (see recipe )

1.5‐ml microcentrifuge tubes
55°C incubator
85°C water bath
0.2‐ml PCR microtubes (Dominique Dutscher, cat. no. 01600)
Thermal cycler (Gene Amp PCR 9700; Applied Biosystems)
Gloves (Laboratories Euromedis, cat. no. 127587)
Syringe (1‐ml equipped with a 25‐G needle; Terumo, cat. no. BS‐01 H2516)
Gas anesthesia station for rodents (TEM)
Animal electric shaver
Surgical instruments: dissection scissors, straight surgical forceps, needle holder
Suture materials (Ethibond Excel polyester 3‐0; Ethicon, cat. no. X32040)
Microcentrifuge (Eppendorf, cat. no. 5415D)

Additional reagents and equipment for running PCR products on an ethidium bromide–stained 2.0% agarose gel in TBE electrophoresis buffer (Armstrong and Schulz, )

NOTE : All protocols using live animals must first be reviewed and approved by an Institutional Animal Care and Use Committee (IACUC) and must follow officially approved procedures for the care and use of laboratory animals.

Table 0.1.1 MaterialsCustom Designed OligonucleotidesCre PCR Master Mix for 10 Reactions to Identify the K14‐Cre‐ER^T2 TransgeneGeneX PCR Master Mix for 10 Reactions to Identify GeneX WT and L2 Alleles

			Volume of reagent
For Cre‐ER^T2 (see Fig. 1)
TK139	5′‐ATTTGCCTGCATTACCGGTC‐3′
TK 141	5′‐ATCAACGTTTTGTTTTCGGA‐3′
For internal control (myogenin)
ADV28	5′‐TTACGTCCATCGTGGACAGC‐3′
ADV30	5′‐TGGGCTGGGTGTTAGCCTTA‐3′
For GeneX WT, L2 and L‐ alleles, P1, P2, and P3
See Figure
For RXRα alleles
P1, BAA239	5′‐TCAAGTGAGGTGGACATTAGGATG‐3′
P2, BAA982	5′‐CTGGAAGAGGATGGGCACTATTCT‐3′
P3, BAA983	5′‐AAACTGCAAGTGGCCTTGAGAAGAA‐3′
Reagent	Initial concentration of reagent	Final concentration of reagent	1 reaction	10 reactions
PCR buffer (see recipe )	10×	1×	3 µl	30 µl
dNTPs (see recipe )	10 mM each	100 µM	0.3 µl	3 µl
Forward primer TK139	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer TK141	100 µM	0.33 µM	0.1 µl	1 µl
Forward primer ADV28	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer ADV30	100 µM	0.33 µM	0.1 µl	1 µl
Taq DNA polymerase a	5 u/µl	1 U	0.2 µl	2 µl
Water			24.1 µl	241 µl
			Volume of reagent
Reagent	Initial concentration of reagent	Final concentration of reagent	1 reaction	10 reactions
PCR buffer (see recipe )	10×	1×	3 µl	30 µl
dNTPs (see recipe )	10 mM each	100 µM	0.3 µl	3 µl
Forward primer P1 (i.e., BAA239 for RXRα)	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer P2 (i.e., BAA982 for RXRα)	100 µM	0.33 µM	0.1 µl	1 µl
Taq polymerase b	5 u/µl	1 U	0.2 µl	2 µl
Water			24.3 µl	243 µl

Table 0.1.2 MaterialsCustom Designed OligonucleotidesCre PCR Master Mix for 10 Reactions to Identify the K14‐Cre‐ER^T2 TransgeneGeneX PCR Master Mix for 10 Reactions to Identify GeneX WT and L2 Alleles

			Volume of reagent
For Cre‐ER^T2 (see Fig. 1)
TK139	5′‐ATTTGCCTGCATTACCGGTC‐3′
TK 141	5′‐ATCAACGTTTTGTTTTCGGA‐3′
For internal control (myogenin)
ADV28	5′‐TTACGTCCATCGTGGACAGC‐3′
ADV30	5′‐TGGGCTGGGTGTTAGCCTTA‐3′
For GeneX WT, L2 and L‐ alleles, P1, P2, and P3
See Figure
For RXRα alleles
P1, BAA239	5′‐TCAAGTGAGGTGGACATTAGGATG‐3′
P2, BAA982	5′‐CTGGAAGAGGATGGGCACTATTCT‐3′
P3, BAA983	5′‐AAACTGCAAGTGGCCTTGAGAAGAA‐3′
Reagent	Initial concentration of reagent	Final concentration of reagent	1 reaction	10 reactions
PCR buffer (see recipe )	10×	1×	3 µl	30 µl
dNTPs (see recipe )	10 mM each	100 µM	0.3 µl	3 µl
Forward primer TK139	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer TK141	100 µM	0.33 µM	0.1 µl	1 µl
Forward primer ADV28	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer ADV30	100 µM	0.33 µM	0.1 µl	1 µl
Taq DNA polymerase a	5 u/µl	1 U	0.2 µl	2 µl
Water			24.1 µl	241 µl
			Volume of reagent
Reagent	Initial concentration of reagent	Final concentration of reagent	1 reaction	10 reactions
PCR buffer (see recipe )	10×	1×	3 µl	30 µl
dNTPs (see recipe )	10 mM each	100 µM	0.3 µl	3 µl
Forward primer P1 (i.e., BAA239 for RXRα)	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer P2 (i.e., BAA982 for RXRα)	100 µM	0.33 µM	0.1 µl	1 µl
Taq polymerase b	5 u/µl	1 U	0.2 µl	2 µl
Water			24.3 µl	243 µl

^a 5 U/µl; Sigma, cat. no. D4545.

Table 0.1.3 MaterialsCustom Designed OligonucleotidesCre PCR Master Mix for 10 Reactions to Identify the K14‐Cre‐ER^T2 TransgeneGeneX PCR Master Mix for 10 Reactions to Identify GeneX WT and L2 Alleles

			Volume of reagent
For Cre‐ER^T2 (see Fig. 1)
TK139	5′‐ATTTGCCTGCATTACCGGTC‐3′
TK 141	5′‐ATCAACGTTTTGTTTTCGGA‐3′
For internal control (myogenin)
ADV28	5′‐TTACGTCCATCGTGGACAGC‐3′
ADV30	5′‐TGGGCTGGGTGTTAGCCTTA‐3′
For GeneX WT, L2 and L‐ alleles, P1, P2, and P3
See Figure
For RXRα alleles
P1, BAA239	5′‐TCAAGTGAGGTGGACATTAGGATG‐3′
P2, BAA982	5′‐CTGGAAGAGGATGGGCACTATTCT‐3′
P3, BAA983	5′‐AAACTGCAAGTGGCCTTGAGAAGAA‐3′
Reagent	Initial concentration of reagent	Final concentration of reagent	1 reaction	10 reactions
PCR buffer (see recipe )	10×	1×	3 µl	30 µl
dNTPs (see recipe )	10 mM each	100 µM	0.3 µl	3 µl
Forward primer TK139	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer TK141	100 µM	0.33 µM	0.1 µl	1 µl
Forward primer ADV28	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer ADV30	100 µM	0.33 µM	0.1 µl	1 µl
Taq DNA polymerase a	5 u/µl	1 U	0.2 µl	2 µl
Water			24.1 µl	241 µl
			Volume of reagent
Reagent	Initial concentration of reagent	Final concentration of reagent	1 reaction	10 reactions
PCR buffer (see recipe )	10×	1×	3 µl	30 µl
dNTPs (see recipe )	10 mM each	100 µM	0.3 µl	3 µl
Forward primer P1 (i.e., BAA239 for RXRα)	100 µM	0.33 µM	0.1 µl	1 µl
Reverse primer P2 (i.e., BAA982 for RXRα)	100 µM	0.33 µM	0.1 µl	1 µl
Taq polymerase b	5 u/µl	1 U	0.2 µl	2 µl
Water			24.3 µl	243 µl

^b 5 U/µl; Sigma, cat. no. D4545.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 1. Schematic structure of the K14‐Cre‐ER^T2 transgene. The human K14 promoter, the Cre‐ER^T2 coding sequence, and the simian virus 40 polyadenylation signal (polyA) are represented by blue, yellow, and purple boxes, respectively. The rabbit β‐globin intron and splice donor‐ and acceptor‐sites are depicted by a line and pink boxes, respectively. The position of the PCR primers TK139 and TK141, and the length of the PCR‐amplified DNA segment are indicated. The sequence of the K14‐Cre‐ER^T2 transgene is available upon request.

View Image

Figure 2. Schematic diagram of a target GeneX WT allele, a floxed GeneX L2 allele, and a GeneX L‐ allele generated by Cre‐mediated excision. Two exons (En and En+1) of GeneX are boxed. P1, P2, and P3 are PCR primers used to identify GeneX WT, L2, and L‐ alleles are indicated. Arrowheads represent loxP sites.

View Image

Figure 3. Identification of K14‐Cre‐ER^T2 transgenic mice by PCR‐mediated tail genomic DNA amplification. PCR‐amplified DNA segments were run on a 2% agarose gel. Lanes 5 to 9, amplification products from 5 pups (Pu 1 to 5). Lanes 2 and 3, amplification products from K14‐Cre‐ER^T2 and WT mice, respectively. Lane 4, PCR reaction without genomic DNA (lysis solution). Lane 1, DNA ladder (L). The size of the DNA segments is given in base pairs. Cre, DNA segment amplified from the K14‐Cre‐ER^T2 transgene with the primer pair TK139 and TK141 (Fig. ). IC (Internal control): DNA segment amplified from an endogenous mouse gene (myogenin) with the primer pair ADV28 and ADV30. Pu1, Pu3, and Pu4 are transgenic for K14‐Cre‐ER^T2 ; Pu2 and Pu5 are not.

View Image

Figure 4. Identification of RXRα WT and L2 alleles by PCR‐mediated tail genomic DNA amplification. PCR‐amplified DNA segments with the primer BAA239 (P1) and BAA982 (P2) were run on a 2% agarose gel. Lanes 5 to 9, amplification products from 5 pups (Pu 1 to 5). Lanes 2 and 3, amplification products from floxed RXRα^L2/L2 and WT mice, respectively. Lane 4, PCR reaction without genomic DNA (lysis solution). Lane 1, DNA ladder (L). The size of the DNA segments is in base pairs. The position of the PCR product amplified with BAA239 and BAA982 from RXRα WT (WT; 158 bp) and L2 floxed alleles (L2; 199 bp) are indicated. Pu1 and Pu5 show RXRα WT alleles; Pu2, Pu3, and Pu4 show one RXRα WT allele and one RXRα L2 allele.

View Image

Figure 5. Analysis of K14‐Cre‐ER^T2 ‐mediated recombination of “floxed” RXRα in genomic DNA of adult skin. L2 and L‐ RXRα alleles were identified by PCR analysis of genomic DNA extracted from epidermis “E” or dermis “D” isolated from the tail two weeks after administration of either tamoxifen (tam) or vehicle (veh) to K14‐Cre‐ER ^T2(tg/0) /RXRα ^L2/L2 and K14‐Cre‐ER ^T2(0/0) /RXRα^L2/L2 mice (lanes 5 to 10), as indicated. Lanes 2 and 3, amplification products from RXRα^L2/L2 and RXRα^L‐/+ mice, respectively. The PCR products corresponding to the RXRα WT (158 bp) and RXRα L2 (199 bp) alleles were amplified with primers BAA239 (P1) and BAA982 (P2) (top panel); the PCR products corresponding to RXRα L‐ alleles (133 bp) were amplified with primers BAA239 (P1) and BAA983 (P3) (bottom panel). Lane 1, DNA ladder (L). The size of the DNA segments is given in base pairs.

View Image

Videos

Literature Cited

Literature Cited
	Armstrong, J.A. and Schulz, J.R. 2008. Agarose gel electrophoresis. Curr. Protoc. Essential Laboratory Techniques 1:7.2.1‐7.2.20.
	Berton, T.R., Matsumoto, T., Page, A., Conti, C.J., Deng, C.X., Jorcano, J.L., and Johnson, D.G. 2003. Tumor formation in mice with conditional inactivation of Brca1 in epithelial tissues. Oncogene 22:5415‐5426.
	Branda, C.S. and Dymecki, S.M. 2004. Talking about a revolution: The impact of site‐specific recombinases on genetic analyses in mice. Dev. Cell 6:7‐28.
	Calleja, C., Messaddeq, N., Chapellier, B., Yang, H., Krezel, W., Li, M., Metzger, D., Mascrez, B., Ohta, K., Kagechika, H., Endo, Y., Mark, M., Ghyselinck, N.B., and Chambon, P. 2006. Genetic and pharmacological evidence that a retinoic acid cannot be the RXR‐activating ligand in mouse epidermis keratinocytes. Genes Dev. 20:1525‐1538.
	Diamond, I., Owolabi, T., Marco, M., Lam, C., and Glick, A. 2000. Conditional gene expression in the epidermis of transgenic mice using the tetracycline‐regulated transactivators tTA and rTA linked to the keratin 5 promoter. J Invest. Dermatol. 115:788‐794.
	el Marjou, F., Janssen, K.P., Chang, B.H., Li, M., Hindie, V., Chan, L., Louvard, D., Chambon, P., Metzger, D., and Robine, S. 2004. Tissue‐specific and inducible Cre‐mediated recombination in the gut epithelium. Genesis 39:186‐193.
	Fadloun, A., Kobi, D., Pointud, J.C., Indra, A.K., Teletin, M., Bole‐Feysot, C., Testoni, B., Mantovani, R., Metzger, D., Mengus, G., and Davidson, I. 2007. The TFIID subunit TAF4 regulates keratinocyte proliferation and has cell‐autonomous and non‐cell‐autonomous tumour suppressor activity in mouse epidermis. Development 134:2947‐2958.
	Feil, R. 2007. Conditional somatic mutagenesis in the mouse using site‐specific recombinases. Handb. Exp. Pharmacol. 178:3‐28.
	Feil, R., Wagner, J., Metzger, D., and Chambon, P. 1997. Regulation of Cre recombinase activity by mutated estrogen receptor ligand‐binding domains. Biochem. Biophys. Res. Commun. 237:752‐757.
	Fuchs, E. 2007. Scratching the surface of skin development. Nature 445:834‐842.
	Herrmann, T., Grone, H.J., Langbein, L., Kaiser, I., Gosch, I., Bennemann, U., Metzger, D., Chambon, P., Stewart, A.F., and Stremmel, W. 2005. Disturbed epidermal structure in mice with temporally controlled fatp4 deficiency. J. Invest. Dermatol. 125:1228‐1235.
	Higashi, A.Y., Ikawa, T., Muramatsu, M., Economides, A.N., Niwa, A., Okuda, T., Murphy, A.J., Rojas, J., Heike, T., Nakahata, T., Kawamoto, H., Kita, T., and Yanagita, M. 2009. Direct hematological toxicity and illegitimate chromosomal recombination caused by the systemic activation of CreERT2. J. Immunol. 182:5633‐5640.
	Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G., and Birchmeier, W. 2001. Beta‐Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 105:533‐545.
	Imayoshi, I., Ohtsuka, T., Metzger, D., Chambon, P., and Kageyama, R. 2006. Temporal regulation of Cre recombinase activity in neural stem cells. Genesis 44:233‐238.
	Indra, A.K., Warot, X., Brocard, J., Bornert, J.M., Xiao, J.H., Chambon, P., and Metzger, D. 1999. Temporally‐controlled site‐specific mutagenesis in the basal layer of the epidermis: Comparison of the recombinase activity of the tamoxifen‐inducible Cre‐ER(T) and Cre‐ER(T2) recombinases. Nucleic Acids Res. 27:4324‐4327.
	Indra, A.K., Li, M., Brocard, J., Warot, X., Bornert, J.M., Gerard, C., Messaddeq, N., Chambon, P., and Metzger, D. 2000. Targeted somatic mutagenesis in mouse epidermis. Horm. Res. 54:296‐300.
	Indra, A.K., Dupe, V., Bornert, J.M., Messaddeq, N., Yaniv, M., Mark, M., Chambon, P., and Metzger, D. 2005a. Temporally controlled targeted somatic mutagenesis in embryonic surface ectoderm and fetal epidermal keratinocytes unveils two distinct developmental functions of BRG1 in limb morphogenesis and skin barrier formation. Development 132:4533‐4544.
	Indra, A.K., Mohan, W.S., Frontini, M., Scheer, E., Messaddeq, N., Metzger, D., and Tora, L. 2005b. TAF10 is required for the establishment of skin barrier function in foetal, but not in adult mouse epidermis. Dev. Biol. 285:28‐37.
	Indra, A.K., Castaneda, E., Antal, M.C., Jiang, M., Messaddeq, N., Meng, X., Loehr, C.V., Gariglio, P., Kato, S., Wahli, W., Desvergne, B., Metzger, D., and Chambon, P. 2007. Malignant transformation of DMBA/TPA‐induced papillomas and nevi in the skin of mice selectively lacking retinoid‐X‐receptor alpha in epidermal keratinocytes. J. Invest. Dermatol. 127:1250‐1260.
	Jonkers, J. and Berns, A. 2002. Conditional mouse models of sporadic cancer. Nature Rev. Cancer 2:251‐265.
	Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M., and Berns, A. 2001. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat. Genet. 29:418‐425.
	Li, M., Indra, A.K., Warot, X., Brocard, J., Messaddeq, N., Kato, S., Metzger, D., and Chambon, P. 2000. Skin abnormalities generated by temporally controlled RXRalpha mutations in mouse epidermis. Nature 407:633‐636.
	Li, M., Chiba, H., Warot, X., Messaddeq, N., Gerard, C., Chambon, P., and Metzger, D. 2001. RXR‐alpha ablation in skin keratinocytes results in alopecia and epidermal alterations. Development 128:675‐688.
	Li, M., Messaddeq, N., Teletin, M., Pasquali, J.L., Metzger, D., and Chambon, P. 2005. Retinoid X receptor ablation in adult mouse keratinocytes generates an atopic dermatitis triggered by thymic stromal lymphopoietin. Proc. Natl. Acad. Sci. U.S.A. 102:14795‐14800.
	Li, M., Hener, P., Zhang, Z., Ganti, K.P., Metzger, D., and Chambon, P. 2009. Induction of thymic stromal lymphopoietin expression in keratinocytes is necessary for generating an atopic dermatitis upon application of the active vitamin D3 analogue MC903 on mouse skin. J. Invest. Dermatol. 129:498‐502.
	Malanchi, I., Peinado, H., Kassen, D., Hussenet, T., Metzger, D., Chambon, P., Huber, M., Hohl, D., Cano, A., Birchmeier, W., and Huelsken, J. 2008. Cutaneous cancer stem cell maintenance is dependent on beta‐catenin signalling. Nature 452:650‐653.
	Mao, C.M., Yang, X., Cheng, X., Lu, Y.X., Zhou, J., and Huang, C.F. 2003. Establishment of keratinocyte‐specific Cre recombinase transgenic mice. Yi Chuan Xue Bao 30:407‐413.
	McLean, G.W., Komiyama, N.H., Serrels, B., Asano, H., Reynolds, L., Conti, F., Hodivala‐Dilke, K., Metzger, D., Chambon, P., Grant, S.G., and Frame, M.C. 2004. Specific deletion of focal adhesion kinase suppresses tumor formation and blocks malignant progression. Genes Dev. 18:2998‐3003.
	Metzger, D. and Chambon, P. 2001. Site‐ and time‐specific gene targeting in the mouse. Methods 24:71‐80.
	Metzger, D., Indra, A.K., Li, M., Chapellier, B., Calleja, C., Ghyselinck, N.B., and Chambon, P. 2003. Targeted conditional somatic mutagenesis in the mouse: temporally‐controlled knock out of retinoid receptors in epidermal keratinocytes. Methods Enzymol. 364:379‐408.
	Nenci, A., Huth, M., Funteh, A., Schmidt‐Supprian, M., Bloch, W., Metzger, D., Chambon, P., Rajewsky, K., Krieg, T., Haase, I., and Pasparakis, M. 2006. Skin lesion development in a mouse model of incontinentia pigmenti is triggered by NEMO deficiency in epidermal keratinocytes and requires TNF signaling. Hum. Mol. Genet. 15:531‐542.
	Park, E.J., Sun, X., Nichol, P., Saijoh, Y., Martin, J.F., and Moon, A.M. 2008. System for tamoxifen‐inducible expression of Cre‐recombinase from the Foxa2 locus in mice. Dev. Dyn. 237:447‐453.
	Perl, A.K., Wert, S.E., Nagy, A., Lobe, C.G., and Whitsett, J.A. 2002. Early restriction of peripheral and proximal cell lineages during formation of the lung. Proc. Natl. Acad. Sci. U.S.A. 99:10482‐10487.
	Rajewsky, K., Gu, H., Kuhn, R., Betz, U. A., Muller, W., Roes, J., and Schwenk, F. 1996. Conditional gene targeting. J. Clin. Invest. 98:600‐603.
	Ramirez, A., Page, A., Gandarillas, A., Zanet, J., Pibre, S., Vidal, M., Tusell, L., Genesca, A., Whitaker, D.A., Melton, D.W., and Jorcano, J.L. 2004. A keratin K5Cre transgenic line appropriate for tissue‐specific or generalized Cre‐mediated recombination. Genesis 39:52‐57.
	Ratnacaram, C.K., Teletin, M., Jiang, M., Meng, X., Chambon, P., and Metzger, D. 2008. Temporally controlled ablation of PTEN in adult mouse prostate epithelium generates a model of invasive prostatic adenocarcinoma. Proc. Natl. Acad. Sci. U.S.A. 105:2521‐2526.
	Ruzankina, Y., Pinzon‐Guzman, C., Asare, A., Ong, T., Pontano, L., Cotsarelis, G., Zediak, V.P., Velez, M., Bhandoola, A., and Brown, E. 2007. Deletion of the developmentally essential gene ATR in adult mice leads to age‐related phenotypes and stem cell loss. Cell Stem Cell 1:113‐126.
	Schmidt, E.E., Taylor, D.S., Prigge, J.R., Barnett, S., and Capecchi, M.R. 2000. Illegitimate Cre‐dependent chromosome rearrangements in transgenic mouse spermatids. Proc. Natl. Acad. Sci. U.S.A. 97:13702‐13707.
	Schonig, K., Schwenk, F., Rajewsky, K., and Bujard, H. 2002. Stringent doxycycline dependent control of CRE recombinase in vivo. Nucleic Acids Res. 30:e134.
	Schuler, M., Dierich, A., Chambon, P., and Metzger, D. 2004. Efficient temporally controlled targeted somatic mutagenesis in hepatocytes of the mouse. Genesis 39:167‐172.
	Schuler, M., Ali, F., Metzger, E., Chambon, P., and Metzger, D. 2005. Temporally controlled targeted somatic mutagenesis in skeletal muscles of the mouse. Genesis 41:165‐170.
	Slezak, M., Goritz, C., Niemiec, A., Frisen, J., Chambon, P., Metzger, D., and Pfrieger, F.W. 2007. Transgenic mice for conditional gene manipulation in astroglial cells. Glia 55:1565‐1576.
	Soriano, P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21:70‐71.
	Sprengel, R. and Hasan, M.T. 2007. Tetracycline‐controlled genetic switches. Handb. Exp. Pharmacol. 178:49‐72.
	Stratis, A., Pasparakis, M., Markur, D., Knaup, R., Pofahl, R., Metzger, D., Chambon, P., Krieg, T., and Haase, I. 2006. Localized inflammatory skin disease following inducible ablation of I kappa B kinase 2 in murine epidermis. J. Invest. Dermatol. 126:614‐620.
	Tarutani, M., Itami, S., Okabe, M., Ikawa, M., Tezuka, T., Yoshikawa, K., Kinoshita, T., and Takeda, J. 1997. Tissue‐specific knockout of the mouse Pig‐a gene reveals important roles for GPI‐anchored proteins in skin development. Proc. Natl. Acad. Sci. U.S.A. 94:7400‐7405.
	Vasioukhin, V., Degenstein, L., Wise, B., and Fuchs, E. 1999. The magical touch: Genome targeting in epidermal stem cells induced by tamoxifen application to mouse skin. Proc. Natl. Acad. Sci. U.S.A. 96:8551‐8556.
	Vassar, R., Rosenberg, M., Ross, S., Tyner, A., and Fuchs, E. 1989. Tissue‐specific and differentiation‐specific expression of a human K14 keratin gene in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 86:1563‐1567.
	Vooijs, M., Jonkers, J., and Berns, A. 2001. A highly efficient ligand‐regulated Cre recombinase mouse line shows that LoxP recombination is position dependent. EMBO Rep. 2:292‐297.
	Wendling, O., Bornert, J.M., Chambon, P., and Metzger, D. 2009. Efficient temporally‐controlled targeted mutagenesis in smooth muscle cells of the adult mouse. Genesis 47:14‐18.
	Zhang, Z., Hener, P., Frossard, N., Kato, S., Metzger, D., Li, M., and Chambon, P. 2009. Thymic stromal lymphopoietin overproduced by keratinocytes in mouse skin aggravates experimental asthma. Proc. Natl. Acad. Sci. U.S.A. 106:1536‐1541.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Generation of Spatio‐Temporally Controlled Targeted Somatic Mutations in the Mouse

Abstract

Table of Contents

Materials

Basic Protocol 1: Generation of Temporally Controlled Mutations in Skin Using Mice Expressing Cre‐ERT2 Selectively in Keratinocytes

Figures

Videos

Literature Cited