cDNA Library Construction from Single Cells

互联网2013-12-31

1697

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

cDNA Library Construction from Single Cells (Phillip R. Kramer, National Institute of Neuronal Disorders and Stroke, NIH, Bethesda, Maryland). Analysis of gene expression or comparing gene expression patterns between cells and/or tissues facilitates the identification of molecules activated by a cellular program or by a particular physiological or pharmacological treatment. This unit presents a protocol for studying these molecules at the level of a single cell.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Basic Protocol 1: Production and Amplification of cDNA from Single Cells
Support Protocol 1: Isolation of Individual Cells from Acute Tissue and Tissue Explants Grown in Vitro
Basic Protocol 2: Phage Library Construction and Differential Screening
Support Protocol 2: Gene Expression Profiling Using PCR Amplification of Truncated cDNA Libraries
Reagents and Solutions
Commentary
Figures

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Production and Amplification of cDNA from Single Cells

Materials

Isolated cells in cDNA lysis buffer (see protocol 2 )
200 U/µl MMLV reverse transcriptase with 5× buffer (Life Technologies)
1 to 5 U/µl AMV reverse transcriptase (Life Technologies)
10× PCR buffer II (PE Biosystems)
25 mM MgCl₂ (Perkin Elmer)
20 mg/ml BSA, molecular grade
100 mM solutions of each dATP, dGTP, dCTP, dTTP
5% (v/v) Triton X‐100, RNase‐ and DNase‐free (e.g., Sigma)
PAGE‐purified AL1 primer: ATT GGA TCC AGG CCG CTC TGG ACA AAA TAT GAA TCC (T)₂₄ (Life Technologies)
AmpliTaq DNA polymerase (PE Biosystems)
5× terminal transferase buffer (Life Technologies)
25 U/µl terminal transferase (Boehringer Mannheim)
Mineral oil, molecular biology grade
TE buffer ( appendix 2A ), pH 7.5
Tris‐buffered phenol ( appendix 2A )
24:1 (v/v) chloroform/isoamyl alcohol
100% ethanol
10 mM Tris⋅Cl, pH 7.0 ( appendix 2A )
1.5% (w/v) agarose gel

37°C and 65°C water baths
0.2‐ml thin‐walled reaction tubes
DNA thermal cycler (e.g., Perkin Elmer or equivalent with extended cycle time feature)
1.5‐ml microcentrifuge tubes
Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N ), transfer onto nylon membrane and Southern analysis (CPMB UNITS & )

Support Protocol 1: Isolation of Individual Cells from Acute Tissue and Tissue Explants Grown in Vitro

Materials

Tissue sample
Calcium‐ and magnesium‐free phosphate buffered saline (CMF‐PBS) or Hank's buffered saline solution (CMF‐HBSS; appendix 2A )
CMF‐PBS or CMF‐HBSS containing 0.025% trypsin/0.75 mM EDTA, 37°C
5× MMLV buffer (e.g., Life Technologies)
DEPC‐treated, sterile deionized H₂ O (RNase‐free; appendix 2A )
NP‐40 (e.g., USB)
RNase inhibitors: Prime RNase inhibitor (Eppendorf) and RNA guard (Amersham Pharmacia Biotech)
Stock primer mix (see recipe )

Dissecting microscope
Sterile 60‐ or 100‐mm polystyrene or glass petri dish
Sterile scalpel or razor blade
5‐ml plastic pipets
37°C incubator
0.5‐ml thin‐walled tubes, sterile, RNase‐free
15‐ml polypropylene tubes
Inverted microscope and micromanipulator (e.g., Sutter Instruments)
0.5‐ (i.d.) × 130‐mm glass capillary tubing
Micropipet puller (e.g., Sutter Instruments)
Syringe with attached tubing fitted for the glass capillary tube or microinjector (e.g., Nanoject II, Drummond Scientific)
Sterile 1.5‐ml polypropylene tubes

Basic Protocol 2: Phage Library Construction and Differential Screening

Materials

Cell‐amplified cDNA (see protocol 1 , step )
PCR buffer (see protocol 1 , step )
Tris‐buffered phenol ( appendix 2A )
24:1 (v/v) chloroform/isoamyl alcohol
10 mM and 1 M Tris⋅Cl, pH 7.0 and pH 7.5, respectively ( appendix 2A )
Eco RI restriction enzyme and appropriate buffer ( appendix 1M )
Low‐melting agarose (melts at 65°C at 1.5%, e.g., Seaplaque GTG or NuSieve GTG agarose)
0.5 µg/ml ethidium bromide
PCR prep DNA purification resin (e.g., Promega) or equivalent commercially available DNA gel purification method
100% ethanol
Phage vector DNA (e.g., Lambda ZapII arms, Eco RI cut and dephosphorylated; Stratagene)
200 U/µl high‐concentration ligase and 10× ligase buffer
Phage packaging extract (e.g., Gigapack II gold extract; Stratagene) containing host bacteria (e.g., XL‐1‐Blue MRF′; Stratagene)
10× Taq PCR buffer (150 mM Tris⋅Cl, pH 8.0, 500 mM KCl)
25 mM MgCl₂ in dH₂ O
100 mM solutions of each of dATP, dTTP, dCTP, dGTP
5 µg/ml T7 primer (5′‐TAATACGACTCACTATAGGG‐3′) in TE buffer (Life Technologies)
5 µg/ml T3 primer (5′‐TAACCCTCACTAAAGGGA‐3′) in TE buffer (Life Technologies)
AmpliTaq DNA polymerase (PE Biosystems)
0.5 M NaOH
0.5× sodium phosphate buffer containing 1% (w/v) BSA and 4% (w/v) SDS
APH solution (see recipe )
1‐5 × 10⁷ cpm/ml radiolabeled probe for specific gene or control genes such as tubulin, actin, GAPDH (e.g., labeled as described in CPMB UNIT )
0.5% SDS in 0.5× SSC (see appendix 2A for SSC)
10× PCR buffer II (PE Biosystems)
20 mg/ml BSA
[α‐³² P]dCTP
5% Triton X‐100
PAGE‐purified AL1 primer: ATT GGA TCC AGG CCG CTC TGG ACA AAA TAT GAA TCC (T)24 (Life Technologies)

Thermal cycler
0.2‐ml thin‐walled PCR tubes
37°C and 50°C water baths
Razor blades
1.5‐ml microcentrifuge tubes
137‐mm nylon membranes (e.g., Hybond N+, NEN Genescreen)
20‐G needle
Plastic wrap
Paper towels or Whatman paper
65°C incubator
X‐ray film
Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N ), titering of phage (Stratagene's protocol or unit 5.18 ),Southern transfer (CPMB UNIT ), homology cloning (unit 4.1 ), in situ hybridizations (unit 1.3 )

Support Protocol 2: Gene Expression Profiling Using PCR Amplification of Truncated cDNA Libraries

Materials

Amplified cDNA from a single cell or pooled cellular cDNAs (see protocol 1 )
10× PCR buffer (see protocol 3 ; e.g., Taq Gold PCR buffer)
25 mM MgCl₂
100 mM each dNTP
100 µM PCR primer X dissolved in water or TE buffer
100 µM PCR primer Y dissolved in water or TE buffer
5 U/µl DNA polymerase (e.g., AmpliTaq Gold, PE Biosystems)
Gel loading dye
0.5 µg/ml ethidium bromide ( appendix 2A )

Thermal cycler
0.5‐ml thin‐walled PCR tubes
Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N )

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 4.27.1 Flowchart for producing cDNA libraries from individual cells using the protocols provided in this unit.

View Image

Figure 4.27.2 Flowchart of phage library screening protocol. Duplicate lifts are differentially screened with a probe from the same cell (cell A) and a different cell (cell B) from which the library was produced.

View Image

Figure 4.27.3 Single cells in olfactory explants express LHRH mRNA (Kramer et al., ). (A ) Lane 1: a 360‐bp Bam HI‐ Eco RI (1 ng) fragment from the rat LHRH gene. Lane 2: PCR‐amplified cDNA from a control that contained no cells. Lanes 3 to 9: single bipolar cells maintained in unilateral olfactory explants for 10.5 days. The cDNA smear extends from ∼200 to 1000 bp. The band below 200 bp is the AL1 primer band (arrow). (B ) Southern analysis of the PCR‐amplified cDNA using an LHRH‐specific probe indicates the positive control (lane 1) as well as 4 of 7 individual primary cells positive for LHRH (lanes 4, 7, 8, and 9, 360‐bp and 500‐bp bands). The different band sizes are expected due to a truncated reverse transcription reaction.

View Image

Videos

Literature Cited

Literature Cited
	Becker, I., Becker, K.F., Rohrl, M.H., Minkus, G., Schutze, K., and Hofler, H. 1996. Single‐cell mutation analysis of tumors from stained histologic slides. Lab. Invest. 75:801‐807.
	Brady, G., Barbara, M., and Iscove, N. 1990. Representative in vitro cDNA amplification from individual hemopoietic cells and colonies. Methods Mol. Cell. Biol. 2:17‐25.
	Brunet, J.F., Shapiro, E., Foster, S.A., Kandel, E.R., and Iino, Y. 1991 Identification of a peptide specific for Aplysia sensory neurons by PCR‐based differential screening. Science 252:856‐859.
	Cheetham, J.E., Coleman, P.D., and Chow, N. 1997. Isolation of single immunohistochemically identified whole neuronal cell bodies from post‐mortem human brain for simultaneous analysis of multiple gene expression. J. Neurosci. Methods 77:43‐48.
	Crino, P.B. and Eberwine, J. 1996a. Molecular characterization of the dendritic growth cone: Regulated mRNA transport and local protein synthesis. Neuron 17:1173‐1187.
	Crino, P.B., Trojanowski, J.Q., Dichter, M..A., and Eberwine, J. 1996b. Embryonic neuronal markers in tuberous sclerosis: Single‐cell molecular pathology. Proc. Natl. Acad. Sci. U.S.A. 93:14152‐14157.
	Davis, L.G., Kuehl, W.M., and Battey, J. 1994. Preparation and analysis of RNA from eukaryotic cells. In Basic Methods in Molecular Biology (S. Greenfield and M. Wonsiewicz, eds.) pp.320‐321. Appleton Lange, East Norwalk, Conn.
	Dulac, C. and Axel, R. 1995. A novel family of genes encoding putative pheromone receptors in mammals. Cell 83:195‐206.
	Eberwine, J., Cao, Y., Nair, S., Miyashiro, K., Mackler, S., Finnell, R., Surmeier, J., and Dichter, M. 1995. Mechanisms of neuronal plasticity as analyzed at the single cell level. Prog. Brain Res. 105:117‐126.
	Fend, F., Emmert‐Buck, M.R., Chuaqui, R., Cole, K., Lee, J., Liotta, L.A., and Raffeld, M. 1999. Immuno‐LCM: Laser capture microdissection of immunostained frozen sections for mRNA analysis. Am. J. Pathol. 154:61‐66.
	Fueshko, S. and Wray, S. 1994. LHRH cells migrate on peripherin fibers in embryonic olfactory explant cultures: An in vitro model for neurophilic neuronal migration. Dev. Biol. 166:331‐348.
	Hoon, M.A., Adler, E., Lindemeier, J., Battey, J.F., Ryba, N.J., and Zuker, C.S. 1999. Putative mammalian taste receptors: A class of taste‐specific GPCRs with distinct topographic selectivity. Cell 96:541‐551.
	Kramer, P.R., Krishnamurthy, R., Mitchell, P.J., and Wray, S. 2000. Transcription factor activator protein‐2 is required for continued luteinizing hormone‐releasing hormone expression in the forebrain of developing mice. Endocrinology 141:1823‐1838.
	Li, H.H., Gyllensten, U.B., Cui, X.F., Saiki, R.K., Erlich, H.A., and Arnheim, N. 1988. Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature 335:414‐417.
	O'Dell, D.M., Raghupathi, R., Crino, P.B., Morrison, B., Eberwine, J.H., and McIntosh, T.K. 1998. Amplification of mRNAs from single, fixed, TUNEL‐positive cells. Biotechniques 25:566‐568, 570.
	Rappolee, D.A., Wang, A., Mark, D., and Werb, Z. 1989. Novel method for studying mRNA phenotypes in single or small numbers of cells. J. Cell Biochem. 39:1‐11.
	Skynner, M.J., Sim, J.A., and Herbison, A.E. 1999. Detection of estrogen receptor alpha and beta messenger ribonucleic acids in adult gonadotropin‐releasing hormone neurons. Endocrinology 140:5195‐5201.
	Williams, J.G. 1981. The preparation and screening of a cDNA clone bank. In Genetic Engineering (R. Williamson, ed.) pp. 1‐59. Academic Press, New York.
Key Reference
	Dulac and Axel 1995. See above.
	The single cell amplification protocol was based on methods outlined in this report.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

cDNA Library Construction from Single Cells

Abstract

Table of Contents

Materials

Basic Protocol 1: Production and Amplification of cDNA from Single Cells

Support Protocol 1: Isolation of Individual Cells from Acute Tissue and Tissue Explants Grown in Vitro

Basic Protocol 2: Phage Library Construction and Differential Screening

Support Protocol 2: Gene Expression Profiling Using PCR Amplification of Truncated cDNA Libraries

Figures

Videos

Literature Cited