Identifying Small‐Molecule Modulators of Protein‐Protein Interactions

互联网2013-12-31

1762

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

This unit outlines methods for identifying cyclic peptides that inhibit protein?protein interactions. Proteins of interest are cloned into a two?hybrid system engineered to operate in reverse, allowing the disruption of a protein complex to be coupled to cell growth. Cyclic peptide libraries are generated using an intein?based plasmid construct, and the cyclized sequence is randomized using a PCR procedure. By transforming plasmid libraries into host cells containing the two?hybrid fusions, cyclic peptide inhibitors can be identified by growing the cells under the appropriate selective conditions. A detailed procedure for performing the genetic selection and identifying false positives is provided. Methods for building the two?hybrid protein fusions and optimizing media conditions, as well as an additional protocol for constructing cyclic peptide libraries are also provided.

Keywords: small?molecule; protein?protein; cyclic peptide; two?hybrid; inhibitor

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Basic Protocol 1: Identification of Small‐Molecule Inhibitors of In Vivo Protein‐Protein Interactions by Genetic Selection
Support Protocol 1: Construction and Optimization of a Strain for Inhibitor Selection
Support Protocol 2: Construction of Cyclic Peptide Libraries
Reagents and Solutions
Commentary
Literature Cited
Figures

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Identification of Small‐Molecule Inhibitors of In Vivo Protein‐Protein Interactions by Genetic Selection

Materials

Selection medium (see recipe )
Luria‐Bertani (LB) agar plates ( appendix 4A ) supplemented with 25 µg/ml chloramphenicol
E. coli strain SNS‐126 containing the two‐hybrid reporter and protein domains of interest (or control protein) fused to the bacteriophage repressor DNA‐binding domains ( protocol 2 )
50 to 200 ng cyclic peptide library ( protocol 3 )
SOC broth (see recipe )
1× MMA: diluted from 5× minimal medium A ( appendix 4A )
LB broth ( appendix 4A ) with and without 25 µg/ml chloramphenicol
200 mM IPTG
Oligonucleotide that hybridizes to the intein fragment (in this case, pAR‐NdeI, 5′‐ GGAATTCCATATGGTTAAAGTTATCGGTCGTCGT‐3′)

245 × 245–mm culture plates (Nunc)
100 × 15–mm petri dishes
Electroporator and cuvettes
18 × 100–mm culture tubes
Toothpicks, sterile
Inoculating loops, sterile
Plasmid preparation kit, optional (e.g., QIAquick Spin Miniprep Kit; Qiagen)
96‐well microtiter plates
Multichannel pipettor
DNA sequencing facility

Additional reagents and equipment for growing bacteria ( appendix 4B ), preparing electrocompetent cells for electroporation (Seidman et al., ), and purifying plasmid DNA ( appendix 4C )

NOTE: All reagents used with E. coli cells must be sterile.

Support Protocol 1: Construction and Optimization of a Strain for Inhibitor Selection

Materials

Oligonucleotides (specifically designed)
Plasmid pTHCP16 (Fig. A, for making homodimeric fusions) or pTHCP14 (Fig. C, for making heterodimeric fusions)
DNA template (gene of interest)
2.5 U/ml proofreading PCR polymerase (e.g., Deep Vent, New England Biolabs; Pfu, Stratagene)
0.1 M EDTA, pH 8.0
10% SDS
2.5 mg/ml proteinase K
3 M sodium acetate, pH 5.2
70% (v/v) and 100% ethanol
PCR purification kit (e.g., QIAquick, Qiagen; optional)
DNA purification kit (e.g., QIAquick Spin Miniprep Kit, Qiagen; optional)
Restriction enzymes (specific to the cloning procedure)
Gel extraction kit (e.g., QIAquick gel extraction kit, Qiagen; optional)
T4 DNA ligase (New England Biolabs)
E. coli competent cells (e.g., DH5α): prepared ( appendix 4D ) or purchased from commercial suppliers
LB agar plates ( appendix 4A ) supplemented with 100 µg/ml ampicillin and with and without IPTG (0 to 1 mM)
E. coli strain SNS‐118 (homodimeric reporter) or SNS‐126 (heterodimeric reporter)
CRIM plasmids (E. coli Genetic Stock Center, Yale), optional
Z buffer (see recipe )
Chloroform
0.1% (w/v) SDS
4 mg/ml o ‐nitrophenyl‐β‐D‐galactopyranoside (ONPG): prepared fresh
1 M sodium bicarbonate (Na₂ CO₃ )

¾ in. sterile, optical glass culture tubes, optional
13 × 100–mm glass tubes (disposable)

Additional reagents and equipment for growing bacteria ( appendix 4B ), performing PCR ( appendix 4J ), separating DNA by agarose gel electrophoresis ( appendix 4F ), purifying plasmid DNA ( appendix 4C ), quantitating DNA ( appendix 4K )

NOTE: For more information about preparing, analyzing, and cloning DNA see appendix 44 .

Support Protocol 2: Construction of Cyclic Peptide Libraries

Materials

LB broth ( appendix 4A ) supplemented with 30 µg/ml chloramphenicol
E. coli culture containing plasmid pARCBD‐p (Scott et al., ), or another compatible plasmid
DNA purification kit (e.g., QIAquick Spin Miniprep Kit, Qiagen; optional)
2.5 U/µl proofreading PCR polymerase (e.g., Deep Vent; New England Biolabs) and 10× buffer
2 mM (each) dNTP mix
Oligonucleotide primers
- C+5 (5′‐GGAATTCGCCAATGGGGCGATCGCCCACAATTGTNNSNNSNNSNNSNNSTGCTTAAGTTTTGGC‐3′)
- CBD‐reverse (5′‐GGAATTCAAGCTTTCATTGAAGCTGCCACAAGG‐3′)
- zipper (5′‐GGAATTCGCCAATGGGGCGATCGCC‐3′)
PCR purification kit, optional (e.g., QIAquick,Qiagen)
100 mM EDTA, pH 8
10% (w/v) SDS
2.5 mg/ml proteinase K
Restriction enzymes: Bgl I and Hind III (e.g., New England Biolabs)
Phosphatase (e.g., shrimp alkaline phosphatase; United States Biochemical)
Gel extraction kit (e.g., QIAquick gel extraction kit, Qiagen)
T4 DNA ligase (e.g., Promega)
3 M sodium acetate, pH 5.2
100% ethanol

Thermal cycler
0.05 micron VM nitrocellulose membranes (Millipore), optional
250‐ml beaker, optional

Additional reagents and equipment for purifying plasmid DNA ( appendix 4C ), purifying DNA ( appendix 4E ), performing agarose gel electrophoresis ( appendix 4F ), and quantitating DNA by spectroscopy ( appendix 4K )

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 19.15.1 Engineering the DnaE trans ‐intein of Synechocystis sp. PCC6803 to cyclize an intervening sequence. This strategy is utilized in the SICLOPPS method to make libraries of cyclic peptides (Scott et al., ).

View Image

Figure 19.15.2 Scheme for genetic selection for cyclic peptide inhibitors of protein‐protein interactions (Horswill et al., ). A protein of interest is fused to a repressor DNA‐binding domain, which associates to block expression of three genes encoding HIS3 (IGPD, histidine biosynthesis), kan (aminoglycoside 3′‐phosphotransferase, kanamycin resistance), and lacZ (β‐galactosidase). Background expression can be chemically tuned with 3‐aminotriazole (3‐AT, competitive inhibitor of IGPD) and kanamycin. By placing E. coli host cells on minimal medium lacking histidine, a genetic selection is created that can be used to identify cyclic peptides that inhibit protein‐protein interactions. Reproduced from Horswill et al. () with permission, Copyright 2004 by National Academy of Sciences, U.S.A.

View Image

Figure 19.15.3 Steps involved in the . The points at which Support Protocols 1 and 2 become relevant are indicated.

View Image

Figure 19.15.4 Graphic map of the RTHS plasmids used for making repressor fusions and their respective promoter sequences: (A ) Plasmid pTHCP16 for constructing homodimeric fusions requires a strain containing the phage 434 wild‐type promoter ( E. coli strain SNS118 derivatives). (B ) The wild‐type 434 promoter. (C ) Plasmid pTHCP14 for constructing heterodimeric fusions requires a strain containing the chimeric phage 434·P22 promoter ( E. coli strain SNS126 derivatives). (D )The chimeric 434·P22 promoter.

View Image

Videos

Literature Cited

Literature Cited
	Abel‐Santos, E., Scott, C.P. and Benkovic, S.J. 2003. Use of inteins for the in vivo production of stable cyclic peptide libraries in E. coli. Methods Mol. Biol. 205:281‐294.
	Brennan, M.B. and Struhl, K. 1980. Mechanisms of increasing expression of a yeast gene in Escherichia coli. J. Mol. Biol. 136:333‐338.
	Clackson, T. and Wells, J.A. 1995. A hot spot of binding energy in a hormone‐receptor interface. Science 267:383‐386.
	Cochran, A.G. 2000. Antagonists of protein‐protein interactions. Chem. Biol. 7:R85‐94.
	Di Lallo, G., Castagnoli, L., Ghelardini, P., and Paolozzi, L. 2001. A two‐hybrid system based on chimeric operator recognition for studying protein homo/heterodimerization in Escherichia coli. Microbiology 147:1651‐1656.
	Geyer, C.R., Colman‐Lerner, A., and Brent, R. 1999. “Mutagenesis” by peptide aptamers identifies genetic network members and pathway connections. Proc. Natl. Acad. Sci. U.S.A. 96:8567‐8572.
	Goryshin, I.Y., Jendrisak, J., Hoffman, L.M., Meis, R., and Reznikoff, W.S. 2000. Insertional transposon mutagenesis by electroporation of released Tn5 transposition complexes. Nat. Biotechnol. 18:97‐100.
	Grigoriev, A. 2003. On the number of protein‐protein interactions in the yeast proteome. Nucleic Acids Res. 31:4157‐4161.
	Haldimann, A. and Wanner, B.L. 2001. Conditional‐replication, integration, excision, and retrieval plasmid‐host systems for gene structure‐function studies of bacteria. J. Bacteriol. 183:6384‐6393.
	Hirschmann, R., Hynes, J., Jr., Cichy‐Knight, M.A., van Rijn, R.D., Sprengler, P.A., Spoors, P.G., Shakespeare, W.C., Pietranico‐Cole, S., Barbosa, J., Liu, J., Yao, W., Rohrer, S., and Smith, A.B., 3rd. 1998. Modulation of receptor and receptor subtype affinities using diastereomeric and enantiomeric monosaccharide scaffolds as a means to structural and biological diversity. A new route to ether synthesis. J. Med. Chem. 41:1382‐1391.
	Hoppe‐Seyler, F., Crnkovic‐Mertens, I., Denk, C., Fitscher, B.A., Klevenz, B., Tomai, E., and Butz, K. 2001. Peptide aptamers: new tools to study protein interactions. J. Steroid. Biochem. Mol. Biol. 78:105‐111.
	Horswill, A.R., Savinov, S.N., and Benkovic, S.J. 2004. A systematic method for identifying small‐molecule modulators of protein‐protein interactions. Proc. Natl. Acad. Sci. U.S.A 101:15591‐15596.
	Huang, J. and Schreiber, S.L. 1997. A yeast genetic system for selecting small molecule inhibitors of protein‐protein interactions in nanodroplets. Proc. Natl. Acad. Sci. U.S.A. 94:13396‐13401.
	Joung, J.K., Ramm, E.I., and Pabo, C.O. 2000. A bacterial two‐hybrid selection system for studying protein‐DNA and protein‐protein interactions. Proc. Natl. Acad. Sci. U.S.A. 97:7382‐7387.
	Khlebnikov, A., Datsenko, K.A., Skaug, T., Wanner, B.L., and Keasling, J.D. 2001. Homogeneous expression of the P(BAD) promoter in Escherichia coli by constitutive expression of the low‐affinity high‐capacity AraE transporter. Microbiology 147:3241‐3247.
	Ladant, D. and Karimova, G. 2000. Genetic systems for analyzing protein‐protein interactions in bacteria. Res. Microbiol. 151:711‐720.
	Leanna, C.A. and Hannink, M. 1996. The reverse two‐hybrid system: a genetic scheme for selection against specific protein/protein interactions. Nucleic Acids Res. 24:3341‐3347.
	Marcotte, E.M., Pellegrini, M., Ng, H.L., Rice, D.W., Yeates, T.O., and Eisenberg, D. 1999. Detecting protein function and protein‐protein interactions from genome sequences. Science 285:751‐753.
	Miller, J. 1992. Procedures for working with lac. In A Short Course in Bacterial Genetics, pp. 71‐80. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
	Naumann, T.A., Savinov, S.N., and Benkovic, S.J. 2005. Engineering an affinity tag for genetically encoded cyclic peptides. Biotechnol. Bioeng. 92:820‐830.
	Norman, T.C., Smith, D.L., Sorger, P.K., Drees, B.L., O'Rourke, S.M., Hughes, T.R., Roberts, C.J. Friend, S.H., Fields, S., and Murray, A.W. 1999. Genetic selection of peptide inhibitors of biological pathways. Science 285:591‐595.
	Park, S.H. and Raines, R.T. 2000. Genetic selection for dissociative inhibitors of designated protein‐protein interactions. Nat. Biotechnol. 18:847‐851.
	Ramani, A.K., Bunescu, R.C., Mooney, R.J., and Marcotte, E.M. 2005. Consolidating the set of known human protein‐protein interactions in preparation for large‐scale mapping of the human interactome. Genome Biol. 6:R40.
	Scott, C.P., Abel‐Santos, E., Wall, M., Wahnon, D.C., and Benkovic, S.J. 1999. Production of cyclic peptides and proteins in vivo. Proc. Natl. Acad. Sci. U.S.A. 96:13638‐13643.
	Scott, C.P., Abel‐Santos, E., Jones, A.D., and Benkovic, S.J. 2001. Structural requirements for the biosynthesis of backbone cyclic peptide libraries. Chem. Biol. 8:801‐815.
	Seidman, C.E., Struhl, K., and Sheen, J. 2002. Introduction of plasmid DNA into cells. In Short Protocols in Molecular Biology, 5th ed. (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 1‐29 to 1‐31. John Wiley & Sons, New York.
	Serebriiskii, I.G., Mitina, O., Pugacheva, E.N., Benevolenskaya, E., Kotova, E., Toby, G.G., Khazak, V., Kaelin, W.G., Chernoff, J., and Golemis, E.A. 2002. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12:1785‐1791.
	Tavassoli, A. and Benkovic, S.J. 2005. Genetically selected cyclic‐peptide inhibitors of AICAR transformylase homodimerization. Angew. Chem. Int. Ed. Engl. 44:2760‐2763.
	Toogood, P.L. 2002. Inhibition of protein‐protein association by small molecules: approaches and progress. J. Med. Chem. 45:1543‐1558.
	Vidal, M., Brachmann, R.K., Fattaey, A., Harlow, E., and Boeke, J.D. 1996. Reverse two‐hybrid and one‐hybrid systems to detect dissociation of protein‐protein and DNA‐protein interactions. Proc. Natl. Acad. Sci. U.S.A. 93:10315‐10320.
	Vidal, M. and Endoh, H. 1999. Prospects for drug screening using the reverse two‐hybrid system. Trends Biotechnol. 17:374‐381.
	Walker, J.R., Roth, J.R., and Altman, E. 2001. An in vivo study of novel bioactive peptides that inhibit the growth of Escherichia coli. J. Pept. Res. 58:380‐388.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Identifying Small‐Molecule Modulators of Protein‐Protein Interactions

Abstract

Table of Contents

Materials

Basic Protocol 1: Identification of Small‐Molecule Inhibitors of In Vivo Protein‐Protein Interactions by Genetic Selection

Support Protocol 1: Construction and Optimization of a Strain for Inhibitor Selection

Support Protocol 2: Construction of Cyclic Peptide Libraries

Figures

Videos

Literature Cited