Normalizing cDNA Libraries

互联网2013-12-31

2303

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

The characterization of rare messages in cDNA libraries is complicated by the substantial variations that exist in the abundance levels of different transcripts in cells and tissues. The equalization (normalization) of cDNA is a helpful approach for decreasing the prevalence of abundant transcripts, thereby facilitating the assessment of rare transcripts. This unit provides a method for duplex?specific nuclease (DSN)?based normalization, which allows for the fast and reliable equalization of cDNA, thereby facilitating the generation of normalized, full?length?enriched cDNA libraries, and enabling efficient RNA analyses. Curr. Protoc. Mol. Biol. 90:5.12.1?5.12.27. © 2010 by John Wiley & Sons, Inc.

Keywords: cDNA normalization; duplex?specific nuclease (DSN); normalized cDNA library

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: Duplex‐Specific Nuclease (DSN)–Based Normalization of cDNA
Support Protocol 1: cDNA Synthesis Using the “SMART” Approach
Support Protocol 2: Duplex‐Specific Nuclease (DSN) Activity Testing
Support Protocol 3: Size Fractionation and Directional Cloning of Normalized cDNA
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Duplex‐Specific Nuclease (DSN)–Based Normalization of cDNA

Materials

ds cDNA (700 to 1300 ng; see protocol 2 )
QIAquick PCR Purification Kit (Qiagen)
3 M sodium acetate, pH 4.8 ( appendix 22 )
98% (v/v) ethanol
80% (v/v) ethanol
1‐kb DNA ladder
1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5 )
1× TAE buffer ( appendix 22 ) with and without 0.5 µg/ml ethidium bromide
Trimmer cDNA Normalization Kit (Evrogen; http://www.evrogen.com) including:
- PCR primer‐M1 (10 µM): 5′‐ AAGCAGTGGTATCAACGCAGAGT‐ 3′
- PCR primer‐M2 (10 µM): 5′‐ AAGCAGTGGTATCAACGCAG‐ 3′
- 4× Hybridization buffer (200 mM HEPES, pH 7.5/2 M NaCl)
- Lyophilized DSN (see recipe for preparation of 1U/µl DSN solution)
- 2× DSN master buffer (100 mM Tris⋅Cl, pH 8.0/10 mM MgCl₂ /2 mM DTT)
- DSN storage buffer (50 mM Tris⋅Cl, pH 8.0)
- DSN stop solution (5 mM EDTA)
Thermostable single‐stranded DNA binding (SSB) protein (New England Biolabs, optional)
Molecular biology‐grade mineral oil
Encyclo PCR kit (Evrogen) or Advantage 2 PCR kit (Clontech) including:
- 50× DNA polymerase mix with 10× PCR buffer
- dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP)

Sterile 0.5‐ml PCR tubes (thin‐walled recommended to ensure more efficient heat transfer and maximize thermal‐cycling performance)
PCR thermal cycler (e.g., PTC‐200 DNA Machine, MJ Research)

Additional reagents agarose gel electrophoresis (unit 2.5 ), DSN activity testing (see protocol 3 ), and size fractionation and directional cloning of the normalized cDNA library (see protocol 4 )

NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.

Support Protocol 1: cDNA Synthesis Using the “SMART” Approach

Materials

Isolated total RNA (1 to 2 µg) or 0.5 to 1 µg of poly(A)⁺ RNA (see )
Pair of oligonucleotide adapters (10 µM each, see Fig. )
Molecular biology‐grade mineral oil
One of the following MMLV‐based reverse transcriptases: Superscript II (Invitrogen), Mint (Evrogen), or SMARTScribe (Clontech), with 5× first‐strand buffer (the authors do not recommend the use of Superscript III (Invitrogen) as, in our experience, it does not ensure effective template switching)
20 mM DTT
Encyclo PCR kit (Evrogen) or Advantage 2 PCR kit (Clontech) including:
- 50× DNA polymerase mix with 10× PCR buffer
- dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP)
20 U/µl RNase inhibitor (optional; Ambion)
20 mM MnCl₂
Encyclo PCR kit (Evrogen) or Advantage 2 PCR kit (Clontech) including:
- 50× DNA polymerase mix with 10× PCR buffer
- dNTP mix (containing 10 mM each of dATP, dCTP, dGTP, and dTTP)
10 µM PCR primer‐M1: 5′‐ AAGCAGTGGTATCAACGCAGAGT‐ 3′ (provided with Evrogen Trimmer cDNA Normalization Kit, http://www.evrogen.com)
1‐kb DNA ladder
1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5 )

0.2‐ ml and 0.5‐ml PCR tubes (thin‐walled recommended to ensure more efficient heat transfer and maximize thermal‐cycling performance)
PCR thermal cycler (e.g., PTC‐200 DNA Machine, MJ Research)

Additional reagents and equipment for agarose gel electrophoresis (unit 2.5 )

NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.

Support Protocol 2: Duplex‐Specific Nuclease (DSN) Activity Testing

Materials

100 ng/µl purified plasmid DNA
2× DSN master buffer (see recipe ; also provided with Evrogen Trimmer cDNA Normalization Kit)
10× DSN solution (see recipe )
Molecular biology‐grade mineral oil
DSN storage buffer (50 mM Tris⋅Cl, pH 8.0; appendix 22 ; also provided with Evrogen Trimmer cDNA Normalization Kit)
DSN stop solution (5 mM EDTA; also provided with Evrogen Trimmer cDNA Normalization Kit)
1‐kb DNA ladder
1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5 )

PCR tubes
Thermal cycler

Additional reagents and equipment for agarose gel electrophoresis (unit 2.5 )

NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.

Support Protocol 3: Size Fractionation and Directional Cloning of Normalized cDNA

Materials

2 µg normalized cDNA (from step 38 of the protocol 1 ) flanked by adapter sequences comprising asymmetric Sfi IA and Sfi IB sites (see Fig. )
QIAquick PCR purification kit (Qiagen)
3 M sodium acetate, pH 4.8 ( appendix 22 )
98% (v/v) ethanol
80% (v/v) ethanol
10 to 20 U/µl Sfi I restriction endonuclease with 10× buffer
10× (1 mg/ml) bovine serum albumin (BSA)
1‐kb DNA ladder
1.5% (w/v) agarose gel with ethidium bromide (EtBr) (see unit 2.5 )
1× TAE buffer with and without 0.5 µg/ml ethidium bromide (see unit 2.5 )
T4 DNA ligase with 10× ligation buffer (Promega)
Vector comprising asymmetric Sfi IA and Sfi IB sites; for example, pDNR‐LIB or pTriplEx2 (Clontech), linearized using Sfi I restriction endonuclease

Chromaspin‐1000 columns (Clontech) or equivalent size‐fractionation columns
14°C water bath

Additional reagents and equipment for phenol‐chloroform extraction of DNA (unit 2.5 ) and agarose gel electrophoresis (unit 2.5 )

NOTE: Use only molecular biology‐grade (DNase‐free) reagents and chemicals.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 5.12.1 Schematic outline of DSN‐based cDNA normalization. The black and gray lines represent abundant and rare transcripts, respectively. The rectangles represent the adapter sequences and their complements. Within the rectangles, white indicates the common external parts of the adapters, while gray and black correspond to the internal parts that differ between the 3′ and 5′ adapters, respectively, thereby allowing directional cloning of the cDNA library.

View Image

Figure 5.12.2 Agarose gel electropherogram of amplified human cDNA from the control tube. Aliquots (5 µl) were collected after seven (lane 1), nine (lane 2), 11 (lane 3), and 13 (lane 4) PCR cycles, and analyzed on a 1.5% (w/v) agarose/EtBr gel in 1× TAE buffer. Lane M, 1‐kb DNA ladder (Invitrogen; 0.1 µg). The optimal number of cycles determined in this experiment is 10, because the smear appears in the high‐molecular‐weight region of the gel after 11 PCR cycles.

View Image

Figure 5.12.3 Analysis of cDNA normalization results. Aliquots of PCR products from the control and experimental tubes (5 µl each) were loaded on a 1.5% (w/v) agarose/EtBr gel as follows: Lane 1, cDNA from the control tube (10 PCR cycles); lane 2, cDNA from the S1_DSN1/4 tube; lane 3, cDNA from the S1_DSN1/2 tube; lane 4, cDNA from the S1_DSN1 tube (19 PCR cycles each). In this experiment, efficient normalization was achieved in the S1_DSN1/2 tube (lane 3), while normalization was not completed in the S1_DSN1/4 tube (lane 1). In the S1_DSN1 tube (lane 4), the DSN treatment was excessive, resulting in partial cDNA degradation. Lane M shows a 1‐kb DNA ladder (Invitrogen; 0.1 µg).

View Image

Figure 5.12.4 Schematic outline of SMART cDNA synthesis. The rectangles represent the adapter sequences and their complements.

View Image

Figure 5.12.5 Structures of the adapters and primers used for cDNA synthesis and normalization. Common parts of the adapters and primers are indicated by bold; asymmetric Sfi I sites are underlined; rG, riboguanines.

View Image

Figure 5.12.6 Amplified ds cDNA prepared from total RNA obtained from different sources. (A ) Lane 1, mouse liver; lane 2, mouse skeletal muscle; lane 3, mouse brain; lane 4, human leucocytes; lane 5, human lung; lane 6, human skeletal muscle; lane 7, mosquito grub; lane 8, copepod Pontella sp.; lane 9, tomato Lycopersicon esculentum . Lane M shows a 1‐kb DNA ladder (SibEnzyme). In each case, cDNA was prepared from 1 µl of total RNA and amplified in 16 to 20 PCR cycles. (B ) Amplified ds cDNA prepared from total human brain RNA after 15 (lane 1), 18 (lane 2), 21 (lane 3), and 24 (lane 4) PCR cycles. 1 µg of total RNA was used for cDNA synthesis. PCR products (4 µl per lane) were analyzed on a 1.5% agarose/EtBr gel in 1× TAE buffer alongside 0.1 µg of 1 kb DNA ladder. After 21 cycles, a smear is apparent in the high‐molecular‐weight region of the gel, indicating that the reaction is overcycled. Because the plateau was reached after 20 cycles, the optimal cycle number for this experiment is 18. Lane M shows a 1‐kb DNA ladder (SibEnzyme; 0.1 µg).

View Image

Figure 5.12.7 Agarose gel electropherogram of DSN‐treated plasmid DNA. Samples containing 100 ng of plasmid DNA were incubated with or without DSN in 1× DSN master buffer for 10 min at 65°C. Reactions were stopped using DSN stop solution, and digestion products were analyzed on a 1.5% agarose/EtBr gel in 1× TAE buffer. Lane 1, control DNA (DSN‐free incubation); lane 2, DNA incubated with partially inactive DSN enzyme; lane 3, successful digestion of DNA by DSN. Lane M shows a 1‐kb DNA ladder (SibEnzyme; 0.1 µg).

View Image

Figure 5.12.8 Agarose gel electropherogram of non‐normalized (lane 1) and normalized cDNA (lanes 2 to 4) that has been PCR amplified using a too‐long extension step (6 min). No bright bands are visible, and the normalized cDNA appears as a smear starting from the high‐molecular‐weight region of the gel. Lane M shows a 1‐kb DNA ladder.

View Image

Videos

Literature Cited

Literature Cited
	Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J.D. 1994. Molecular biology of the cell. 3rd ed. Garland Publishing, New York.
	Anisimova, V.E., Rebrikov, D.V., Shagin, D.A., Kozhemyako, V.B., Menzorova, N.I., Staroverov, D.B., Ziganshin, R., Vagner, L.L., Rasskazov, V.A., Lukyanov, S.A., and Shcheglov, A.S. 2008. Isolation, characterization and molecular cloning of duplex‐specific nuclease from the hepatopancreas of the Kamchatka crab. BMC Biochem. 21:14.
	Bogdanova, E.A., Shagina, I.A., Mudrik, E., Ivanov, I., Amon, P., Vagner, L.L., Lukyanov, S.A., and Shagin, D.A. 2009. DSN depletion is a simple method to remove selected transcripts from cDNA populations. Mol. Biotechnol. 41:247‐253.
	Calvo, E. and Ribeiro, J.M. 2006. A novel secreted endonuclease from Culex quinquefasciatus salivary glands. J. Exp. Biol. 209:2651‐2659.
	Carninci, P., Kvam, C., Kitamura, A., Ohsumi, T., Okazaki, Y., Itoh, M., Kamiya, M., Shibata, K., Sasaki, N., Izawa, M., Muramatsu, M., Hayashizaki, Y., and Schneider, C. 1996. High‐efficiency full‐length cDNA cloning by biotinylated CAP trapper. Genomics 37:327‐336.
	Carninci, P., Shibata, Y., Hayatsu, N., Sugahara, Y., Shibata, K., Itoh, M., Konno, H., Okazaki, Y., Muramatsu, M., and Hayashizaki, Y. 2000. Normalization and subtraction of cap‐trapper‐selected cDNAs to prepare full‐length cDNA libraries for rapid discovery of new genes. Genome Res. 10:1617‐1630.
	Carninci, P., Waki, K., Shiraki, T., Konno, H., Shibata, K., Itoh, M., Aizawa, K., Arakawa, T., Ishii, Y., Sasaki, D., Bono, H., Kondo, S., Sugahara, Y., Saito, R., Osato, N., Fukuda, S., Sato, K., Watahiki, A., Hirozane‐Kishikawa, T., Nakamura, M., Shibata, Y., Yasunishi, A., Kikuchi, N., Yoshiki, A., Kusakabe, M., Gustincich, S., Beisel, K., Pavan, W., Aidinis, V., Nakagawara, A., Held, W. A., Iwata, H., Kono, T., Nakauchi, H., Lyons, P., Wells, C., Hume, D. A., Fagiolini, M., Hensch, T. K., Brinkmeier, M., Camper, S., Hirota, J., Mombaerts, P., Muramatsu, M., Okazaki, Y., Kawai, J., and Hayashizaki, Y. 2003. Targeting a complex transcriptome, the construction of the mouse full‐length cDNA encyclopedia. Genome Res. 13:1273‐1289.
	Chenchik, A., Zhu, Y.Y., Diatchenko, L., Li, R., Hil, L.J., and Siebert, P.D. 1998. Gene cloning and analysis by RT‐PCR. In Biotechniques Books (P. Siebert, and J. Larrick, eds.) pp. 305‐319. Eaton Publishing, Natick, Mass.
	Chomczynski, P. and Sacchi, N. 1987. Single‐step method of RNA isolation by acid guanidinium thiocyanate‐phenol‐chloroform extraction. Anal. Biochem. 162:156‐159.
	Coche, T. and Dewez, M. 1994. Reducing bias in cDNA sequence representation by molecular selection. Nucleic Acids Res. 22:4545‐4546.
	Franz, O., Bruchhaus, I., and Roeder, T. 1999. Verification of differential gene transcription using virtual northern blotting. Nucleic Acids Res. 27:e3.
	Kunitz, M. 1950. Crystalline desoxyribonuclease; digestion of thymus nucleic. 1 acid; the kinetics of the reaction. J. Gen. Physiol. 33:363‐377.
	Liao, T.H. 1974. Bovine pancreatic deoxyribonuclease D. J. Biol. Chem. 249:2354‐2356.
	Luk'ianov, K.A., Gurskaia, N.G., Matts, M.V., Khaspekov, G.L., D'iachenko, L.B., Chenchik, A.A., Il'evich‐Stuchkov, S.G., and Luk'ianov, S.A. 1996. A method for obtaining the normalized cDNA libraries based on the effect of suppression of polymerase chain reaction. Bioorg. Khim. 22:686‐690.
	Maruyama, K. and Sugano, S. 1994. Oligo‐capping: A simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138:171‐174.
	Matz, M.V. 2003. Amplification of representative cDNA pools from microscopic amounts of animal tissue. Methods Mol. Biol. 221:103‐116.
	Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
	Schmidt, W.M. and Mueller, M.W. 1999. CapSelect: A highly sensitive method for 5′ CAP‐dependent enrichment of full‐length cDNA in PCR‐mediated analysis of mRNAs. Nucleic Acids Res. 27:e31.
	Shagin, D.A., Rebrikov, D.V., Kozhemyako, V.B., Altshuler, I.M., Shcheglov, A.S., Zhulidov, P.A., Bogdanova, E.A., Staroverov, D.B., Rasskazov, V.A., and Lukyanov, S. 2002 A novel method for SNP detection using a new duplex‐specific nuclease from crab hepatopancreas. Genome Res. 12:1935‐1942.
	Soares, M., Bonaldo, M., Jelene, P., Su, L., Lawton, L., and Efstratiadis, A. 1994. Construction and characterization of a normalized cDNA library. Proc. Natl. Acad. Sci. U.S.A. 91:9228‐9232.
	Wells, C.A., Ravasi, T., Sultana, R., Yagi, K., Carninci, P., Bono, H., Faulkner, G., Okazaki, Y., Quackenbush, J., Hume, D.A., and Lyons, P.A. 2003. Continued discovery of transcriptional units expressed in cells of the mouse mononuclear phagocyte lineage. Genome Res. 13:1360‐1365.
	Young, B.D. and Anderson, M. 1985. Quantitative analysis of solution hybridization. In Nucleic Acids Hybridisation, a Practical Spproach (B.D. Hames and S.J. Higgins, eds.) pp. 47‐71. IRL Press, Washington, D.C.
	Zhao, Y., Hoshiyama, H., Shay, J.W., and Wright, W.E. 2008. Quantitative telomeric overhang determination using a double‐strand specific nuclease. Nucleic Acids Res. 36:e14.
	Zhu, Y.Y., Machleder, E.M., Chenchik, A., Li, R., and Siebert, P.D. 2001. Reverse transcriptase template switching, a SMART approach for full‐length cDNA library construction. Biotechniques 30:892‐897.
	Zhulidov, P.A., Bogdanova, E.A., Shcheglov, A.S., Vagner, L.L., Khaspekov, G.L., Kozhemyako, V.B., Matz, M.V., Meleshkevitch, E., Moroz, L.L., Lukyanov, S.A., and Shagin, D.A. 2004. Simple cDNA normalization using kamchatka crab duplex‐specific nuclease. Nucleic Acid Res. 32:e37.
	Zhulidov, P.A., Bogdanova, E.A., Shcheglov, A.S., Shagina, I.A., Wagner, L.L., Khazpekov, G.L., Kozhemyako, V.V., Lukyanov, S.A., and Shagin, D.A. 2005. A method for the preparation of normalized cDNA libraries enriched with full‐length sequences. Russ. J. Bioorganic Chem. 31:170‐177.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Normalizing cDNA Libraries

Abstract

Table of Contents

Materials

Basic Protocol 1: Duplex‐Specific Nuclease (DSN)–Based Normalization of cDNA

Support Protocol 1: cDNA Synthesis Using the “SMART” Approach

Support Protocol 2: Duplex‐Specific Nuclease (DSN) Activity Testing

Support Protocol 3: Size Fractionation and Directional Cloning of Normalized cDNA

Figures

Videos

Literature Cited