果蝇RNAi的实验中双链短RNA的合成（dsRNA)方法

We suggest using the Primer3 website for designing primers. Complementary sequences should be 20-24 nt, the Tm range between 59℃ - 61℃ and optimize against self-annealing by setting the Max Complementarity to 5 and Max 3' Complementarity to 1. After choosing the primer sequence, add the T7 promoter sequence (TAATACGACTCACTATAGGGAGA) to the 5' end.

Perform a standard 50 or 100µl PCR reaction using your selected primer sequences to amplify the region of interest. Use 1-2 µl of a 10µM primer stock, 100-200 ng DNA as template and DNA polymerase. We have successfully used GeneChoice Taq (PGC Scientifics #62-6086-01), TaqPlus (Stratagene #600210), and Herculase (Stratagene #NC9690330) in the following PCR reaction conditions:

1. 94℃ - 3 min.

2. 94℃ - 45 sec.

3. 57℃ - 30 sec.

4. 72℃ - 45 sec.

5. steps 2-4, 30x

6. 72℃ - 10 min.li

Check the PCR results to ensure that you have a band of the expected size. I run 4μl in a 1% agarose gel and use the small combs. I also us a 250bp ladder.

We use the Ambion MEGAscript T7 kit (Cat.# : 1334) for the transcription reaction. Follow the Ambion MEGAscript kit protocol for Transcription Reaction Assembly and use 5 µl of PCR template per 20 µl reaction. It is not necessary to purify the PCR template before transcription. We incubate the reaction in a heat block or thermocycler for 4 hours. Following incubation, we remove the DNA template with the DNase. Transcription and annealing occur simultaneously and no additional step is required to anneal the tw℃omplementary. If you want more dsRNA, scale up the reaction.

Confirm that the dsRNA product is the correct size using a 1% agarose gel with TBE or TAE buffer and load only 0.5 µl.

Purify using Qiagen's RNAeasy (#74104) or Ambion's NucAway Spin Columns (#10070). Ambion also has a MEGAclear column which is reported to work but has not been tested in this lab. When using Qiagen's RNAeasy columns, follow the RNA cleanup protocol and elute twice to maximize yield. Also, if you scale up the 20 µl reaction and are using Qiagen's RNAeasy columns, divide the reaction and purify in two or more columns in order to not overload a single column. If you are performing reactions in a 96 well format, purify the dsRNA in Millipore Multiscreen PCR plates (#MANU03050). In our opinion, the Qiagen RNAeasy 96 well plates often perform inconsistently and can be difficult to use.

Measure the OD 260 of 1:50 dilution. Calculate the concentration by measuring the OD 260 of 1:50 - 1:100 dilution. Then multiply the OD260 by the dilution factor and an extinction coefficient of 45 (dsRNA Concentration = OD260 x Diln. x 45). The standard output of 20 µl reaction is 80 - 200 µg, with 120 µg as a frequently observed value.

The dsRNA can be stored at -20℃, or at -70℃ as a precipitate with 0.1x sodium acetate and 2.5x ethanol.

Templates can be generated by PCR using purified plasmid as a template. The entire inserted sequence can be amplified using T7 & SP6 or T7 & T3 promoter primers depending on the plasmid.

Check the PCR results to ensure that you have a band of the expected size.

We use the Ambion MEGAscript T7, T3, & SP6 kits (Cat.# : 1334, 1338, 1330) for the transcription reaction. With T7 & SP6 or T7 & T3 promoters, each transcription reaction will occur in a separate tube. Follow the Ambion MEGAscript kit protocol and use 5 µl of PCR template per 20 µl reaction. It is not necessary to purify the PCR template before transcription.

When the reactions are complete (generally after 2-4 hours) check 0.5 µl of each product on an agarose gel.

Purify each strand using Ambion's NucAway Spin Columns. I would not advise using the Qiagen RNAeasy columns due to the fact that the two strands never annealed after using them.

To anneal, combine equal molar amounts of each transcript into one tube. Then, place the tube in a boiling water bath, turn the heat off, and leave overnight to anneal. Check again on a 1% agarose gel, measure the concentration, aliquot, and store.

Worby CA, Simonson-Leff N, Dixon JE. (2001) RNA interference of gene expression (RNAi) in cultured Drosophila cells. Sci STKE (95):PL1.

Dixon Lab - dixonlab.biochem.med.umich.edu - look under 'Protocols'

Carthew Lab - www.biochem.northwestern.edu/carthew/