Studies of the Ubiquitin Proteasome System

互联网2013-12-31

7746

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

A concept that has arisen over the last decade is that proteins can, in general, be covalently modified by polypeptides, resulting in alterations in their fate and function. The first?identified and most well studied of these modifying polypeptides is ubiquitin. Although targeting for proteasomal degradation is the best studied outcome of ubiquitylation, we now understand that modification of proteins with ubiquitin has numerous other cellular roles that alter protein function and that are unrelated to proteasomal degradation. Ubiquitylation is a complex process that is regulated at the level of both addition and removal of ubiquitin from target proteins. This unit includes a number of different basic protocols that will facilitate the study of components of the ubiquitin system and substrate ubiquitylation both in vitro and in cells. Because another protein modifier, NEDD8, itself regulates aspects of the ubiquitin system, basic protocols on neddylation are also included in this unit.

Keywords: Ubiquitin; ubiquitylation; proteasomal degradation; protein modification; NEDD8; E1; E2; E3

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Assays of E1 and E2 Activity
Basic Protocol 1: Thiolester Formation Between Rabbit E1 and Ubiquitin
Basic Protocol 2: Thiolester Formation Between E2 and Ubiquitin
Binding of Ubiquitin‐Proteasome Proteins
Basic Protocol 3: Binding of E2s to E3s
Alternate Protocol 1: Binding of Ubiquitin Substrates to E3s
In Vitro Ubiquitylation (E3) Assays
Basic Protocol 4: E3 Auto‐Ubiquitylation
Basic Protocol 5: Determination of Auto‐Ubiquitylation versus Pseudo‐Substrate Ubiquitylation
Basic Protocol 6: Ubiquitylation of E3 Enzymes Expressed in In Vitro Translation Systems
Alternate Protocol 2: Determination of Ubiquitin Chain Variant Phenotype
Basic Protocol 7: Chelation of Zinc from RING‐ and PHD‐Finger E3s
Alternate Protocol 3: Inhibition of HECT Domain E3s by Alkylation of Active‐Site Cysteines
Substrate Ubiquitylation in Vitro
Basic Protocol 8: Substrate Ubiquitylation in Solution
Alternate Protocol 4: Substrate Ubiquitylation After E3 Binding
Basic Protocol 9: Substrate Ubiquitylation by Multisubunit E3s
Basic Protocol 10: Detection of E3 Activity in Immunoprecipitated Protein
Alternate Protocol 5: Detection of Ubiquitin Modification of Substrates After GST Pull‐Down
Detection of Ubiquitylation in Vivo
Basic Protocol 11: Lysis and Immunoprecipitation of Ubiquitylated Protein
Alternate Protocol 6: Detection of Protein Ubiquitylation Using Tagged Ubiquitin
Inhibition of Ubiquitylation and Protein Degradation In Vivo
Basic Protocol 12: Use of Dominant Negative Ubiquitin Proteins in Cells
Alternate Protocol 7: Use of Small Interfering RNAs (siRNAs) to Reduce Expression of Ubiquitin‐Proteasome System Proteins in Cells
Basic Protocol 13: Localizing Degradation to the Proteasome
The NEDD8 Conjugation System
Basic Protocol 14: Purification of APP‐BP1/Uba3 Complex (E1 for NEDD8) Expressed Using the Baculovirus Expression System
Support Protocol 1: Batch Purification of APP‐BP1 and Uba3
Support Protocol 2: Column Purification of APP‐BP1 and Uba3
Basic Protocol 15: Production of Ubc12 and NEDD8 in Bacterial Expression Systems
Basic Protocol 16: In Vitro Neddylation
Labeling and Detection of Ubiquitin
Basic Protocol 17: Radiolabeling Ubiquitin with 32P
Alternate Protocol 8: Radiolabeling Ubiquitin with 125Iodine
Alternate Protocol 9: Labeling Ubiquitin with Nonradioactive Tag (Biotin)
Alternate Protocol 10: Generation of Tagged Ubiquitin Expression Plasmids
Basic Protocol 18: Immunoblotting with Anti‐Ubiquitin
Generation and Purification of Rabbit Anti‐Ubiquitin Antibodies
Basic Protocol 19: Generation and Purification of Anti‐Ubiquitin Antibodies
Support Protocol 3: Preparation of Ubiquitin Affinity Column
Generation of Reagent‐Grade Ubiquitin Activating Enzyme (E1)
Basic Protocol 20: Preparation of Wheat E1 in E. coli
Basic Protocol 21: Preparation of Mouse E1 in Insect Cells Using a Baculovirus System
Alternate Protocol 11: Preparation of Rabbit E1
Support Protocol 4: Generation of Empty Bacterial Lysates
Generation of Ubiquitin‐Conjugating Enzymes (E2s)
Basic Protocol 22: Expression of E2s in E. coli Without a Purification Tag
Alternate Protocol 12: Purification of E2s from E. coli Using an Affinity Tag
Alternate Protocol 13: Purification of E2s from E. coli Using Anti–Affinity Tag Antibodies
Basic Protocol 23: Expression of E2s with in Vitro Transcription and Translation Systems
In Vitro Production of Ubiquitin‐Protein Ligases (E3s)
Basic Protocol 24: Expression of Ring‐Finger E3s in Bacterial Lysates
Alternate Protocol 14: Expression of HECT and U‐Box E3s in Bacterial Lysates
Alternate Protocol 15: Expression of Unstable E3s in Bacterial Lysates
Basic Protocol 25: Expression of E3s in Eukaryotic in Vitro Translation Systems
Basic Protocol 26: Expression of Multi‐Subunit E3s Using a Baculovirus Expression System
Support Protocol 5: Batch Purification of Multimeric E3s
Support Protocol 6: Column Purification of Multimeric E3s
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Thiolester Formation Between Rabbit E1 and Ubiquitin

Materials

E1: rabbit E1 (Calbiochem, Boston Biochem, Affiniti), bacterially expressed wheat E1 ( protocol 33 ), or mouse E1 ( protocol 34 )
100 mM HEPES, pH 7.5
10× thiolester buffer (see recipe )
[³² P]ubiquitin ( protocol 26 ) or 10 µg/µl “cold” (unlabeled) ubiquitin (Sigma) for immunoblot detection
4× nonreducing SDS‐PAGE sample buffer (see recipe )
4× reducing SDS‐PAGE sample buffer (see recipe )
6% to 8% SDS‐PAGE minigels (unit 6.1 )
Anti‐ubiquitin antibody ( protocol 31 ; for immunoblot detection)
Boiling water bath

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 ) or immunoblotting ( protocol 30 )

Basic Protocol 2: Thiolester Formation Between E2 and Ubiquitin

Materials

E1: rabbit E1 (Calbiochem, Boston Biochem, Affiniti,), bacterially expressed wheat E1 ( protocol 33 ), or mouse E1 ( protocol 34 )
100 mM HEPES, pH 7.5
E2: crude (Basic Protocol protocol 3722 or protocol 4023 ) or purified ( protocol 38 or protocol 3913 ) or commercially available
10× thiolester buffer (see recipe )
[³² P]ubiquitin ( protocol 26 )
4× nonreducing SDS‐PAGE sample buffer (see recipe )
4× reducing SDS‐PAGE sample buffer (see recipe )
18% to 20% SDS‐PAGE minigels (unit 6.1 )
Anti‐ubiquitin antibody ( protocol 31 ; optional)
Boiling water bath

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 ) or immunoblotting ( protocol 30 )

Basic Protocol 3: Binding of E2s to E3s

Materials

E3 or other putative E2 binding site of interest expressed as a GST fusion protein (see protocol 41 and Alternate Protocols protocol 4214 and protocol 4315 )
Glutathione‐Sepharose 4B beads (50% slurry; GE Healthcare)
Phosphate‐buffered saline (PBS; see recipe ), 4°C
Binding buffer (see recipe ), 4°C
Purified native E2 (see Alternate Protocols protocol 3812 and protocol 3913 ; for detection by Coomassie blue staining or immunoblotting), E2 fusion with GST, His or other tag (Wu et al., ; for detection by Coomassie blue staining or immunoblotting), or ³⁵ S‐labeled E2 (see protocol 40 ; for detection by autoradiography)
4× nonreducing SDS‐PAGE sample buffer (see recipe )
4× reducing SDS‐PAGE sample buffer (see recipe )
18% to 20% SDS‐PAGE minigels (unit 6.1 )
10% (v/v) acetic acid/25% methanol
Anti‐E2 or anti‐tag antibody (Calbiochem, Boston Biochem, Affinity; for immunoblotting)

End‐over‐end rotator
Boiling water bath
Gel densitometer

Additional reagents and equipment for Coomassie blue staining (unit 6.6 ), autoradiography and phospher imaging (unit 6.3 ), or immunoblotting (unit 6.2 )

Alternate Protocol 1: Binding of Ubiquitin Substrates to E3s

In vitro–translated ³⁵ S‐labeled substrate protein ( protocol 44 )
50 mM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO
10% (v/v) acetic acid/25% (v/v) methanol

Basic Protocol 4: E3 Auto‐Ubiquitylation

Materials

Glutathione‐Sepharose (GS) beads (GE Healthcare)
50 mM Tris⋅Cl, pH 7.5 ( appendix 2A )
Putative E3 expressed as a GST fusion in bacteria (GST‐E3; protocol 44 )
Empty bacterial lysate ( protocol 36 )
Wheat E1 ( protocol 33 ), mouse E1 ( protocol 34 ), or rabbit E1 (Calbiochem)
E2 ( protocol 37 )
10× PCK (see recipe )
10× ubiquitylation buffer 1 (see recipe )
[³² P]ubiquitin ( protocol 26 )
50 mM Tris⋅Cl, pH 7.5 ( appendix 2A )
4× reducing SDS‐PAGE sample buffer (see recipe )
10% (v/v) acetic acid/25% methanol

30°C Thermomixer (Eppendorf), or other heated shaker
Boiling water bath

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 )

Basic Protocol 5: Determination of Auto‐Ubiquitylation versus Pseudo‐Substrate Ubiquitylation

Materials

Putative E3 expressed as a GST fusion in bacteria ( protocol 44 )
Glutathione‐Sepharose (GS) beads (GE Healthcare)
Empty bacterial lysate ( protocol 36 )
Wheat E1 ( protocol 33 ), mouse E1 ( protocol 34 ), or rabbit E1 (Calbiochem)
E2 ( protocol 37 )
10× PCK (see recipe )
10× ubiquitylation buffer 1 (see recipe )
[³² P]ubiquitin ( protocol 26 )
50 mM Tris⋅Cl, pH 7.5
20× thrombin stock solution (see recipe )
Phosphate‐buffered saline (PBS; see recipe )
Ubiquitylation buffer 2 for E3 assays (see recipe ; optional)
Thermomixer, or other heated shaker

Additional reagents and equipment for in vitro ubiquitylation ( protocol 6 ), SDS‐PAGE (unit 6.1 ), and autoradiography (unit 6.3 ).

Basic Protocol 6: Ubiquitylation of E3 Enzymes Expressed in In Vitro Translation Systems

Materials

50 mM MG132 (Calbiochem, Boston Biochem, or BioMol) in DMSO
30 µM ubiquitin aldehyde (Calbiochem, Boston Biochem, or BioMol) in 1 M HEPES, pH 8.0
50 ng/µl E1 (Basic Protocols protocol 3421 and protocol 3722 )
50 ng/µl E2 (e.g., Ube2d2/UbcH5B; protocol 37 )
10× PCK (see recipe )
10× ubiquitylation buffer 1 (see recipe ) or 20× ubiquitylation buffer 2 for E3 assays (see recipe )
10 mg/ml ubiquitin (Sigma)
Suspected E3 protein, expressed with ³⁵ S label in reticulocyte or wheat germ lysates (25,000 to 100,000 cpm; protocol 40 )
4× reducing SDS sample buffer (see recipe )
10% (v/v) acetic acid/25% methanol
30°C Thermomixer (Eppendorf), or other heated shaker

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 )

Alternate Protocol 2: Determination of Ubiquitin Chain Variant Phenotype

20× ubiquitylation buffer 2 for E3 assays (see recipe )
Mutant ubiquitins: lysine‐less (K0), K48R, K63R, K48 only, K63 only (BioMol, Boston Biochem, or made in house)
Wild‐type ubiquitin as reference

Additional reagents and equipment for anti‐ubiquitin immunoblotting ( protocol 30 )

Basic Protocol 7: Chelation of Zinc from RING‐ and PHD‐Finger E3s

Materials

Putative E3 expressed as a GST fusion in bacteria ( protocol 41 ).
Glutathione‐Sepharose (GS) beads (GE Healthcare)
50 mM Tris⋅Cl, pH 7.5 ( appendix 2A )
Zinc chelating agents (Sigma): 5 to 10 mM EDTA, 5 to 10 mM EGTA, 5 to 10 mM DTPA, 1 to 5 mM TPEN, or 1 to 5 mM o ‐phenanthroline in 50 mM Tris⋅Cl, pH 7.5
5 mM ZnCl₂
Wheat E1 ( protocol 33 ), mouse E1 ( protocol 34 ), or rabbit E1 (Calbiochem)
E2 ( protocol 37 )
Empty bacterial lysate ( protocol 36 )
10× PCK (see recipe )
10× ubiquitylation buffer 1 (see recipe )
[³² P]ubiquitin ( protocol 26 )
4× reducing SDS‐PAGE sample buffer (see recipe )

End‐over‐end rotator
Gel‐loading pipet tips
30°C Thermomixer (Eppendorf), or other heated shaker

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 )

Alternate Protocol 3: Inhibition of HECT Domain E3s by Alkylation of Active‐Site Cysteines

Alkylating agents: 10 mM iodoacetamide (IAA) or 5 mM N‐ethylmaleamide (NEM) in Tris⋅Cl, pH 7.5 (see appendix 2A for buffer)

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 ) or immunoblotting (unit 6.2 )

Basic Protocol 8: Substrate Ubiquitylation in Solution

Materials

50 µM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO
30 µM ubiquitin aldehyde (Calbiochem, Boston Biochem, or BioMol) in 1 M HEPES, pH 8.0
50 ng/µl E1 ( protocol 33 or protocol 3421 )
50 ng/µl E2 ( protocol 37 or protocol 4023 )
10× PCK (see recipe )
10× ubiquitylation buffer 1 (see recipe )
10 mg/ml ubiquitin
Substrate, expressed with ³⁵ S‐label in reticulocyte or wheat germ lysates (25,000 to 100,000 cpm; see protocol 40 )
E3, expressed as a GST fusion in bacteria ( protocol 41 )
4× reducing SDS‐PAGE sample buffer (see recipe )
20× ubiquitylation buffer 2 for E3 assays (see recipe ; optional)

30°C Thermomixer (Eppendorf), or other heated shaker
Boiling water bath

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 )

Alternate Protocol 4: Substrate Ubiquitylation After E3 Binding

Glutathione‐Sepharose (GS) beads (GE Healthcare)
50 mM Tris⋅Cl, pH 7.5 ( appendix 2A )
Binding buffer (see recipe )
1× SDS‐PAGE sample buffer: 4× sample buffer (see recipe ) diluted to 1× with binding buffer (see recipe )

End‐over‐end rotator
30°C Thermomixer (Eppendorf), or other heated shaker

Basic Protocol 9: Substrate Ubiquitylation by Multisubunit E3s

Materials

VBC‐Cul2 E3 protein complex expressed and purified using baculoviral expression system ( protocol 45 )
Mouse E1 ( protocol 34 )
E2‐UbcH5B ( protocol 37 )
GST‐ubiquitin ( protocol 29 )
Human APP‐BP1/Uba3 (NEDD8 E1; protocol 21 )
Ubc12 (E2 for NEDD8), expressed and purified by using bacterial expression system ( protocol 24 )
NEDD8, expressed and purified by using bacterial expression system ( protocol 24 )
MBP‐HIF2α‐ODD (Megumi et al., 2005 ) expressed and purified by using bacterial expression system
His₆ ‐EGLN3 (proline hydroxylases of HIF‐α; Megumi et al., 2005 ), expressed and purified by using bacterial expression system (note that this is necessary for proline hydroxylation of MBP‐ODD)
10× ATP and ATP‐regenerating system (see recipe )
10× ubiquitylation buffer 2 for multisubunit E3s and neddylation (see recipe )
40 mM sodium 2‐oxoglutarate (α‐ketoglutarate, sodium salt; Sigma)
40 mM ascorbic acid (Sigma)
Anti‐MBP antibody (Santa Cruz Biotechnology)

Boiling water bath
Thermomixer, or other heated shaker

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and immunoblotting (unit 6.2 )

Basic Protocol 10: Detection of E3 Activity in Immunoprecipitated Protein

Materials

Adherent cells expressing the substrate protein and E3 of interest (e.g., U2OS cells for p53 and MDM2), growing in 100‐mm dishes
50 mM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO or other proteasome inhibitor (e.g., lactacystin; Calbiochem or Biomol)
Phosphate‐buffered saline (PBS; see recipe )
Nondenaturing Triton X‐100 lysis buffer (see recipe ) containing 1× phosphatase inhibitors and 50 µM MG132 (or lactacystin)
Anti‐E3 or anti‐substrate antibody
Nondenaturing Triton X‐100 wash buffer (see recipe )
Tris‐buffered saline (TBS; appendix 2A ; optional)
30 µM ubiquitin aldehyde (Calbiochem, Boston Biochem, or BioMol) in 1 M HEPES, pH 8.0
E1: rabbit (Calbiochem, Boston Biochem, Affiniti,), bacterially expressed wheat E1 ( protocol 33 ), or mouse E1 ( protocol 34 )
E2: crude ( protocol 37 or protocol 4023 ) or purified ( protocol 38 or protocol 3913 )
20× ubiquitin buffer 2 for E3 assays (see recipe )
10 mg/ml ubiquitin
4× reducing sample buffer

30°C Thermomixer (Eppendorf), or other heated shaker
Boiling water bath

Additional reagents and equipment for cell culture (unit 1.1 ), immunoprecipitation (unit 7.2 ), SDS‐PAGE (unit 6.1 ) and immunoblotting (unit 6.2 )

Alternate Protocol 5: Detection of Ubiquitin Modification of Substrates After GST Pull‐Down

Glutathione‐Sepharose (GS) beads (GE Healthcare)
50 mM Tris⋅Cl, pH 7.5 ( appendix 2A )
End‐over‐end rotator

Basic Protocol 11: Lysis and Immunoprecipitation of Ubiquitylated Protein

Materials

Protein A–Sepharose CL‐4B beads (50% slurry; GE Healthcare)
Tris‐buffered saline (TBS; appendix 2A ), 4°C
Specific antibody for the protein of interest and isotype‐matched control antibody, e.g., irrelevant or preimmune serum, purified
Tris‐buffered saline/Tween 20 (TBST; see recipe ), 4°C
Cells growing in culture (unit 1.1 )
Phosphate‐buffered saline (PBS; see recipe ), ice cold
Nondenaturing Triton X‐100 lysis buffer (see recipe ), ice cold
2× reducing SDS‐PAGE sample buffer (see recipe for 4×)
Anti–specific antigen antibody
Anti‐ubiquitin antibody

End‐over‐end rotator
Boiling water bath

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and immunoblotting ( protocol 30 and unit 6.2 )

Alternate Protocol 6: Detection of Protein Ubiquitylation Using Tagged Ubiquitin

Cells to be transfected
1 M CaCl₂
Mammalian expression plasmid for ubiquitin fused to FLAG, HA, His₆ , myc‐tag, GFP, or GST tag ( protocol 29 , or obtained by request from other investigators)
Transfection efficiency control plasmid, e.g., GFP, RFP, β‐galactosidase
2× HEPES‐buffered saline (HeBS; see recipe )
Anti– tag epitope antibody or anti‐substrate antibody (e.g., Sigma for anti‐FLAG; Santa Cruz‐ Biotechnology for other antibodies)
6‐well tissue culture plates
Boiling water bath

Additional reagents and equipment for cell culture (unit 1.1 )

Basic Protocol 12: Use of Dominant Negative Ubiquitin Proteins in Cells

Materials

Expression plasmids for mutant and wild‐type E2 or E3
Cultured cells to be transfected (e.g., U2OS or 293T)
Nondenaturing Triton X‐100 lysis buffer (see recipe ), ice cold
Specific antibody to the protein of interest and matched control antibody, e.g., irrelevant antibody or serum from unimmunized rabbits
Antibodies to mutated/wild‐type protein or substrate or ubiquitin

Additional reagents and equipment for transfection ( protocol 17 ), SDS‐PAGE (unit 6.1 ), immunoblotting (unit 6.2 ), and immunoprecipitation ( protocol 16 )

Alternate Protocol 7: Use of Small Interfering RNAs (siRNAs) to Reduce Expression of Ubiquitin‐Proteasome System Proteins in Cells

Materials

Cultured cells to be transfected (e.g., U2OS or 293T)
Inhibitors (Calbiochem, Boston Biochem, Biomol):
- Calpain inhibitor I (CPI, also known as LlnL or ALLN), soluble in DMSO
- Calpain inhibitor II (CPII, also known as ALLM), soluble in DMSO
- MG132, soluble in DMSO
- Lactacystin, soluble in DMSO or water, but unstable in H₂ O
- NH₄ Cl in H₂ O
Nondenaturing Triton X‐100 lysis buffer (see recipe )
4× reducing SDS‐PAGE sample buffer (see recipe )
Specific antibody against protein of interest
6‐well tissue culture dishes

Additional reagents and equipment for cell culture (unit 1.1 ), SDS‐PAGE (unit 6.1 ), and immunoblotting (unit 6.2 )

Basic Protocol 13: Localizing Degradation to the Proteasome

Materials

Sf 9 cells or Sf 21 cells (Invitrogen)
Complete Grace's insect medium (see recipe )
cDNAs encoding APP‐BP1 and Uba3
Baculovirus transfer vectors (see Murphy et al., 2004 )
Hypotonic lysis buffer (see recipe )
1 M imidazole, pH 7.5 (adjusted with HCl)
Ni‐NTA beads (50% slurry; Qiagen)

25‐cm² culture flasks (Nunc) or 100‐mm tissue culture dishes
27°C incubator without enhanced CO₂
175‐cm² tissue culture flasks
15‐ml centrifuge tubes
Refrigerated centrifuge
15‐ml Dounce homogenizer with tight‐fitting pestle
15‐ml and 50‐ml centrifuge tubes

Additional reagents and equipment for maintenance of insect cell cultures and generation of recombinant baculovirus (Murphy et al., 2004 ) and batch ( protocol 22 ) or column ( protocol 23 ) purification of APP‐BP1 and Uba3

Basic Protocol 14: Purification of APP‐BP1/Uba3 Complex (E1 for NEDD8) Expressed Using the Baculovirus Expression System

Materials

NEDD8 E1 on Ni‐NTA agarose beads ( protocol 21 )
Wash buffer 1 for His₆ ‐tagged proteins (see recipe )
Wash buffer 2 for His₆ ‐tagged proteins (see recipe )
Elution buffer for His₆ ‐tagged proteins (see recipe )
Dialysis buffer (see recipe ; include DTT)
Glycerol
Refrigerated centrifuge
1.5‐ml screw‐cap microcentrifuge tubes
End‐over‐end rotator
8000‐MWCO dialysis membrane

Additional reagents and equipment for dialysis ( appendix 3C )

NOTE: Perform all steps at 4°C.

Support Protocol 1: Batch Purification of APP‐BP1 and Uba3

Materials

NEDD8 E1 on Ni‐NTA agarose beads ( protocol 21 )
Wash buffer 1 for His₆ ‐tagged proteins (see recipe )
Wash buffer 2 for His₆ ‐tagged proteins (see recipe )
Elution buffer for His₆ ‐tagged proteins (see recipe )
Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe ; include DTT)
Glycerol

2‐ml Poly‐Prep disposable chromatography column (Bio‐Rad)
8000‐MWCO dialysis membrane

Additional reagents and equipment for dialysis ( appendix 3C )

NOTE: Perform all steps at 4°C.

Support Protocol 2: Column Purification of APP‐BP1 and Uba3

Materials

Ubc12 or NEDD8 plasmids (Kawakami et al., 2001 )
E. coli strain BL21(DE3) (Invitrogen)
2×YT + G medium (see recipe ) with 50 µg/ml ampicillin
1 M IPTG (dissolve 1 g IPTG in 4.2 ml H₂ O; store at −20°C)
Sonication buffer (see recipe ) or Ni‐NTA purification buffer (see recipe )
Liquid N₂
1 M imidazole, pH 7.5 (adjusted with HCl)
Ni‐NTA beads (Qiagen)
Wash buffer 1 for His₆ ‐tagged proteins (see recipe )
Wash buffer 2 for His₆ ‐tagged proteins (see recipe )
Elution buffer for His₆ ‐tagged proteins (see recipe )
Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe ; include DTT)
Glycerol
37°C shaking incubator or water bath
Refrigerated centrifuge
Probe sonicator
15‐ml centrifuge tubes
End‐over‐end rotator
Screw‐cap 1.5‐ml microcentrifuge tubes
8000‐MWCO dialysis membrane

Additional reagents and equipment for transforming bacteria with plasmids (Seidman et al., 1997 ) and dialysis ( appendix 3C )

Basic Protocol 15: Production of Ubc12 and NEDD8 in Bacterial Expression Systems

Materials

VBC‐Cul2 E3 protein complex expressed and purified by using baculoviral expression system ( protocol 21 )
Human APP‐BP1/Uba3 (NEDD8 E1), expressed and purified by using baculoviral expression system ( protocol 21 )
Ubc12 (E2 for NEDD8; protocol 24 )
NEDD8 ( protocol 25 )
10× ATP and ATP‐regenerating system (see recipe )
10× ubiquitylation buffer 2 for E3s and neddylation (see recipe )
4× nonreducing SDS‐PAGE sample buffer (see recipe )
Antibody to detect Cul2 (e.g., anti‐myc antibody; Covance)

37°C Thermomixer (Eppendorf), or other heated shaker
Boiling water bath

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ) and immunoblotting (unit 6.2 )

Basic Protocol 16: In Vitro Neddylation

Materials

E. coli BL21(DE3) or other protease‐deficient bacterial strain (Novagen or Invitrogen)
pGEX‐2TK‐ubiquitin plasmid (purchase from GE Healthcare or prepare in house as in protocol 29 )
1 M IPTG (dissolve 1 g IPTG in 4.2 ml H₂ O, store at −20°C)
Sonication buffer (see recipe )
Glutathione‐Sepharose beads (GE Healthcare)
Phosphate‐buffered saline (PBS; see recipe )
4× reducing SDS‐PAGE sample buffer (see recipe )
12% SDS‐PAGE gel (unit 6.1 )
10× kinase buffer (see recipe )
Protein kinase A catalytic subunit from bovine heart (259 U; Sigma), resuspend lyophilized powder in 25 µl of 40 mM DTT on ice, allow to solubilize 15 min; prepare fresh
[γ‐³² P]ATP (GE Healthcare) 6000 Ci/mmol
20× thrombin stock solution (see recipe )
Benzamidine‐Sepharose (GE Healthcare)
Eco‐Scint A (National Diagnostics)
Elution buffer for GST proteins (see recipe )

Refrigerated centrifuge and centrifuge bottles
Probe sonicator (e.g., Misonix Sonicator 3000)
Refrigerated centrifuge
Platform shaker
End‐over‐end rotator
Nitrocellulose filter circles
4‐ml scintillation vials
β scintillation counter

Additional reagents and equipment for transforming bacteria with plasmids (Seidman et al., 1997 ), SDS‐PAGE (unit 6.1 ), and staining of gels with Coomassie blue (unit 6.6 )

Basic Protocol 17: Radiolabeling Ubiquitin with 32P

Materials

20 mg/ml bovine ubiquitin (Sigma‐Aldrich) in coupling buffer
Coupling buffer: 50 mM sodium borate, pH 8.5
10 mg/ml Sulfo‐NHS‐LC‐Biotin (Pierce) in coupling buffer (prepare immediately prior to use)
1 M Tris Cl, pH 8.5 ( appendix 2A )
20 mM Tris Cl, pH 7.4 ( appendix 2A )

PD‐10 column prepacked with Sephadex G‐25 medium (GE Healthcare)
2000‐MWCO dialysis membrane

Alternate Protocol 8: Radiolabeling Ubiquitin with 125Iodine

Materials

Whole RNA from any eukaryote, or total yeast DNA
Primer for reverse transcription (if starting with whole eukaryotic RNA): RT 3′ reverse: ATATAGAATTCCTATCCTCCTCTCAGGCGAAGGACCAGGT 3′ (synthesized at 100 nM scale, and desalted, by IDT, http://www.idtdna.com, Invitrogen, or similar oligonucleotide synthesis facility)
Kit for first‐stand cDNA synthesis (e.g., RT‐PCR kit; Fermentas)
Kit for PCR amplification of DNA (e.g., RT‐PCR kit, Fermentas, or Ready‐To‐Go PCR beads, GE Healthcare)
Primers for PCR:
- 5′ forward: ATATAGGATCCCAGATCTTCGTGAAGACCCT
- 3′ reverse: ATATAGAATTCCTATCCTCCTCTCAGGCGAAGGACCAGGT
QIAquick PCR Purification Kit (Qiagen)
Bam HI and Eco R1 restriction endonucleases and 10× Eco RI buffer
pGEX‐2TK vector (GE Healthcare)
1% agarose gels with and without ethidium bromide (Voytas, )
Molecular weight markers
Calf intestinal alkaline phosphatase (CIAP; Roche)
QIAquick Gel Extraction Kit (Qiagen)
T4 DNA ligase kit (Takara)
TOP10 chemically competent E. coli strain DH5α (Invitrogen) or other suitable host bacterial strain
SOC medium (Digene)
LB medium ( appendix 2A ) with ampicillin
100‐mm LB agar plates containing 100 µg/ml ampicillin ( appendix 2A )
Ready‐To‐Go PCR kit (containing PCR tubes premixed PCR reagents; GE Healthcare)
DNA size markers

14°, 42°C. 56° and 65°C water baths
96‐well microtiter plate
15‐ml snap‐cap culture tubes (e.g., Falcon 2059)

Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), transformation of bacteria (Seidman et al., 1997 ), DNA minipreps (Engebrecht et al., ), and DNA sequencing (Chapter 7 in Ausubel et al., 2006 )

Alternate Protocol 9: Labeling Ubiquitin with Nonradioactive Tag (Biotin)

Materials

Protein samples to be analyzed
0.5% (v/v) glutaraldehyde (Sigma) in 0.1 M sodium phosphate, pH 7.0 ( appendix 2A )
Phosphate‐buffered saline (PBS; see recipe )
TBST/BSA (see recipe for TBST)
1.5 µg/ml polyclonal rabbit anti‐ubiquitin (commercially available or prepared as in protocol 31 ) or monoclonal anti‐ubiquitin in TBST/BSA
TBST buffer (see recipe )
[¹²⁵ I]protein A (MP Biomedicals Life Science Division, or see recipe ) or HRP‐conjugated anti–rabbit Ig and chemiluminescent detection reagents (SuperSignal West Pico, Pierce, or ECL Plus, GE Healthcare)
Biomax MR film (Kodak)

Additional reagents and equipment for SDS‐PAGE (unit 6.1 ), blotting from gels to PDVF or nitrocellulose membranes (unit 6.2 ), and autoradiography (unit 6.3 )

Alternate Protocol 10: Generation of Tagged Ubiquitin Expression Plasmids

Materials

Chicken albumin or ovalbumin, KLH, or other suitable hapten
Ubiquitin (from bovine erythrocytes; Sigma)
0.1 M potassium phosphate buffer, pH 7.0 ( appendix 2A )
3% (v/v) glutaraldehyde in potassium phosphate buffer, pH 7.0
Phosphate buffered saline (PBS; see recipe )
10% (w/v) SDS
Rabbits
Complete Freund's adjuvant (CFA, Sigma)
Incomplete Freund's adjuvant (IFA, Sigma)
Sodium azide
Ubiquitin‐agarose affinity column (see protocol 32 )
0.2 M glycine, pH 2.7
2 M Tris base
PBS (see recipe ) containing 0.02% (w/v) sodium azide
1 M KCl

15‐ml tube
10,000‐MWCO dialysis membrane
90°C water bath
Tabletop and refrigerated centrifuges

Additional reagents and equipment for preparing antigens with adjuvants (unit 16.1 ), immunoblotting ( protocol 30 ), and dialysis ( appendix 3C )

Basic Protocol 18: Immunoblotting with Anti‐Ubiquitin

Materials

Affi‐Gel‐10 slurry (Bio‐Rad)
4 mg/ml ubiquitin (Sigma) in 0.1 M NaHCO₃ /0.5 M NaCl, pH 8.0
1 M ethanolamine, pH 8.0
0.2 M glycine, pH 4.0 (adjusted with HCl)
Phosphate‐buffered saline (PBS; see recipe )
1 M KCl
1% (w/v) sodium azide

Fritted‐glass filter, coarse
50‐ml conical centrifuge tubes

Basic Protocol 19: Generation and Purification of Anti‐Ubiquitin Antibodies

Materials

pET E1 plasmid (request from R. Vierstra, University of Wisconsin at Madison, or A. Weissman)
E. coli strain BL21 transformation‐competent bacteria (Novagen)
SOC medium (Digene)
LB plates ( appendix 2A ) containing the appropriate selection antibiotic
LB medium ( appendix 2A ) containing the appropriate selection antibiotic
1 M IPTG (dissolve 1 g IPTG in 4.2 ml water; store at −20°C)
Sonication buffer (see recipe )
E2 of choice

42°C water bath
Platform shaker
Refrigerated centrifuge
Probe sonicator (e.g., Misonix Sonicator 3000)

Support Protocol 3: Preparation of Ubiquitin Affinity Column

Materials

Sf 9 cells (Invitrogen)
Complete Grace's insect medium (see recipe )
Baculovirus (AcMNPV) stock encoding His₆ ‐tagged E1, recently titered
Baculovirus lysis buffer 2 (see recipe )
5% (w/v) agarose (SeaKem from FMC or Baculovirus Agarose from Invitrogen) in H₂ O
Grace's insect medium (Invitrogen), serum free
1% (w/v) neutral red (Sigma)

175‐cm² tissue culture flasks and 60‐mm tissue culture dishes, plus other appropriate tissue culture vessels (Table 15.9.2 )
50‐ml conical polypropylene centrifuge tubes
60°C and 47°C water baths
Refrigerated centrifuge
Probe sonicator (e.g., Misonix Sonicator 3000)

Additional reagents and equipment for maintenance of insect cell cultures and generation of recombinant baculovirus (Murphy et al., 2004 )

Basic Protocol 20: Preparation of Wheat E1 in E. coli

PET3a, pET15b or other vector for expression of proteins in E. coli from a T7 promoter but without a protein sequence

Basic Protocol 21: Preparation of Mouse E1 in Insect Cells Using a Baculovirus System

Materials

pET expression vector (Novagen) containing cDNA for E2 of interest

Additional reagents and equipment for transforming bacteria with pET plasmid and preparing crude lysates of bacteria ( protocol 33 ), purification of E2 ( protocol 38 or protocol 3913 ), and testing E2 activity ( protocol 2 )

Alternate Protocol 11: Preparation of Rabbit E1

Materials

Affinity matrix (Ni‐NTA agarose from Qiagen; Talon from Clontech; or equivalent product from Invitrogen)
50 mM sodium phosphate, pH 8.0 ( appendix 2A )
Bacterial lysate containing E2 protein ( protocol 37 )
1 M imidazole, pH 7.5 (adjusted with HCl)
Wash buffer 1 for His₆ ‐tagged proteins (see recipe )
Elution buffer for His₆ ‐tagged proteins (see recipe )
Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe )
Glycerol
3500‐MWCO dialysis membrane

Additional reagents and equipment for dialysis ( appendix 3C ) and testing E2 activity

Support Protocol 4: Generation of Empty Bacterial Lysates

Materials

Antibody‐agarose conjugates (Santa Cruz Biotechnology; 50% w/v slurry)
50 mM sodium phosphate, pH 7.0
Bacterial lysate containing E2 protein ( protocol 37 )
50 mM Tris⋅Cl, pH 7.4 ( appendix 2A )
200 mM glycine, pH 2.8
1 M Tris base
Dialysis buffer (see recipe )
Glycerol
0.1 M NaOH (optional)
20% ethanol or 50 mM sodium phosphate (pH 7.0)/0.02% (w/v) sodium azide (optional)
3500‐MWCO dialysis membrane

Additional reagents and equipment for dialysis ( appendix 3C ) and testing E2 activity ( protocol 2 )

Basic Protocol 22: Expression of E2s in E. coli Without a Purification Tag

Materials

10× transcription buffer (Promega)
20 to 40 U/µl ribonuclease inhibitor (e.g., RNasin; Promega)
10 mM NTP mix (10 mM each ATP, CTP, GTP, UTP; Promega)
0.5 + 2µg/µl plasmid vector containing cDNA for E2 of interest under the control of a bacteriophage RNA polymerase, e.g., T7, SP6, or T3 (Promega)10 to 20 U/µl RNA polymerase appropriate to vector (SP6, T3, or T7)
0.7% agarose gel in MOPS‐formaldehyde (optional; Brown et al., 2004 )
10× in vitro translation (IVT) buffer (Promega)
Rabbit reticulocyte lysate or wheat germ extract (Promega)
Amino acid mixture (Promega) lacking methionine (−Met), cysteine (−Cys) or lysine (−Lys) depending on amino acid of choice for radiolabeling
50 mM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO
15 µCi/µl [³⁵ S]methionine, [³⁵ S]cysteine, or [¹⁵ N]lysine (1000 Ci/mmol, NEN)
10% (w/v) trichloroacetic acid (TCA; Sigma), cold
EcoScint scintillation fluid (National Diagnostics)

30°C water bath
0.45‐µM HA filters (Millipore)

Additional reagents and equipment for spectrophotometric determination of RNA concentration ( appendix 3D ) or agarose‐formaldehyde gel electrophoresis of RNA (Brown et al., 2004 ) and SDS‐PAGE (unit 6.1 ) and autoradiography (unit 6.3 )

Alternate Protocol 12: Purification of E2s from E. coli Using an Affinity Tag

Materials

E. coli , transformation‐competent strain BL21(DE3) pLysS (Novagen)
E3 plasmid construct (typically pET vectors from Novagen or pGex vectors from GE Healthcare containing E3 cDNA alone or as a tagged fusion protein)
LB agar plates and liquid medium containing appropriate antibiotic ( appendix 2A )
2×YT medium (see recipe ) containing appropriate antibiotic and up to 250 µM ZnCl₂
1 M IPTG (dissolve 1 g IPTG in 4.2 ml water; store at −20°C)
Sonication buffer (see recipe )
Glutathione‐Sepharose (GS) or Ni‐NTA agarose (Ni‐NTA) beads
50 mM Tris⋅Cl, pH 7.5 ( appendix 2A )
2 µg/µl stock solution of bovine serum albumin (BSA; Pierce)

Platform shaker
Spectrophotometer
Probe sonicator (e.g., Misonix Sonicator 300)
Refrigerated centrifuge and round‐bottom centrifuge tubes

Additional reagents and equipment for transforming bacteria with plasmids (Seidman et al., 1997 ), SDS‐PAGE (unit 6.1 ), and staining of gels (unit 6.6 )

Alternate Protocol 13: Purification of E2s from E. coli Using Anti–Affinity Tag Antibodies

Materials

Sf 9 cells or Sf 21 cells (Invitrogen)
Complete Grace's insect medium (see recipe )
Baculovirus lysis buffer 1 (see recipe )
1 M imidazole, pH 7.5 (adjust with HCl)
Ni‐NTA beads (Qiagen)
25‐cm² culture flasks (Nunc) or 100‐mm tissue culture dishes
27°C incubator without enhanced CO₂
175‐cm² tissue culture flasks
15‐ and 50‐ml centrifuge tubes

Additional reagents and equipment for maintenance of insect cell cultures and generation of recombinant baculovirus (Murphy et al., 2004 ) and batch ( protocol 46 ) or column ( protocol 47 ) purification of multimeric E3s

Basic Protocol 23: Expression of E2s with in Vitro Transcription and Translation Systems

Materials

E3 complexes bound to Ni‐NTA beads ( protocol 45 )
Wash buffer 1 for His₆ ‐tagged proteins (see recipe )
Wash buffer 2 for His₆ ‐tagged proteins (see recipe )
Elution buffer for His₆ ‐tagged proteins (see recipe )
Dialysis buffer 1 for ubiquitylating and neddylating enzymes (see recipe )
Glycerol

Refrigerated centrifuge
1.5‐ml screw‐cap microcentrifuge tubes
End‐over‐end rotator
8000‐MWCO dialysis membrane

Additional reagents and equipment for dialysis ( appendix 3C )

Basic Protocol 24: Expression of Ring‐Finger E3s in Bacterial Lysates

Materials

E3 complexes bound to Ni‐NTA beads
Wash buffer 1 for His₆ ‐tagged proteins (see recipe )
Wash buffer 2 for His₆ ‐tagged proteins (see recipe )
Elution buffer for His₆ ‐tagged proteins (see recipe )
Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe )
Glycerol

2‐ml Poly‐Prep disposable chromatography column (Bio‐Rad)
8000‐MWCO dialysis membrane

Additional reagents and equipment for dialysis ( appendix 3C )

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 15.9.1 The ubiquitylation pathway. Free ubiquitin (Ub) is activated in an ATP‐dependent manner with the formation of a thiol‐ester linkage between E1 and the carboxyl terminus of ubiquitin. Ubiquitin is transferred to one of a number of different E2s. E2s associate with E3s, which might or might not have substrate already bound. For HECT domain E3s, ubiquitin is next transferred to the active‐site cysteine of the HECT domain followed by transfer to substrate (S) (as shown) or to a substrate‐bound multi‐ubiquitin chain. For RING E3s, current evidence indicates that ubiquitin might be transferred directly from the E2 to the substrate. Reproduced with permission from Nature Reviews Molecular Cell Biology (A.M. Weissman. 2001. 2:169‐178.) copyright 2001 Mcmillan Magazines Ltd (http://www.nature.com/reviews).

View Image

Figure 15.9.2 Thiolester formation between E1 and ubiquitin (E1∼Ub) or one of two E2s and ubiqutin (E2K∼Ub or E2D2∼Ub). 100 ng of mouse E1 alone and with 100 ng of E2K (E2‐25K, HIP2) or ∼100 ng E2D2 (UbcH5B) were incubated 5 min at room temperature in the presence of ATP and ³² P‐labeled ubiquitin (see ). The samples were then separated on 4% to 20% gradient SDS‐PAGE gels in the absence (nonreducing) or presence (reducing) of 2‐mercaptoethanol. Upon reduction, the higher‐molecular‐weight bands corresponding to ubiquitin‐thiolester‐modified proteins disappear (see Basic Protocols 1 and 2). Here, mouse E1 was expressed in a baculovirus system () and purified on nickel affinity resin. E2D2 was expressed in bacteria and used without further purification (see ). E2K was expressed as a GST‐fusion in bacteria and purified on glutathione Sepharose column with thrombin cleavage (see ; K.L. Lorick, unpub. observ.).

View Image

Figure 15.9.3 [³² P] Ubiquitin‐thioester formation with various E2 enzymes and corresponding ubiquitin ligase activity (See ) with GST‐SNURF protein. The arrow indicates mono‐ubiquitylated protein (From Häkli et al., 2004).

View Image

Figure 15.9.4 In vivo ubiquitylation of a typical RING‐finger protein in U20S cells. Cells in 6‐well plates were transfected with 2 µg Flag‐tagged RING‐finger protein, a mutant version of the RING‐finger protein, or vector alone. In addition, 1 µg of Ube2D2 was transfected in the indicated lanes to enhance the amount of ubiquitylated species. After 24 hr, the cells were lysed in RIPA buffer. 150 µl of lysate was immunoprecipitated with mouse‐anti‐FLAG antibody and immunoprecipitates were resolved on 4% to 20% SDS‐PAGE gels. The protein was transferred to PVDF membrane and immunoblotted with anti‐FLAG antibody (Y. Yang, unpub. observ.).

View Image

Videos

Literature Cited

Literature Cited
	Amir, R.E., Iwai, K., and Ciechanover, A. 2002. The NEDD8 pathway is essential for SCF(beta‐TrCP)‐mediated ubiquitination and processing of the NF‐kappa B precursor p105. J. Biol. Chem. 277:23253‐23259.
	Aravind, L. and Koonin, E.V. 2000. The U box is a modified RING finger: A common domain in ubiquitination. Curr. Biol. 10: R132‐R134.
	Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. 2006. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
	Brown, T., Mackey, K., and Du, T. 2004. Analysis of RNA by northern and slot blot hybridization. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 4.9.1‐4.9.19. John Wiley & Sons, Hoboken, N.J.
	Brzovic, P.S., Keeffe, J.R., Nishikawa, H., Miyamoto, K., Fox, D. 3rd, Fukuda, M., Ohta, T., and Klevit, R. 2003. Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin‐ligase complex. Proc. Natl. Acad. Sci. U.S.A. 100:5646‐5651.
	Chan, A.H., Lee, S.M., Chim, S.S., Kok, L.D., Waye, M.M., Lee, C.Y., Fung, K.P., and Tsui, S.K. 2001. Molecular cloning and characterization of a RING‐H2 finger protein, ANAPC11, the human homolog of yeast Apc11p. J. Cell Biochem. 83:249‐258.
	Coligan, J.E., Bierer, B., Marguiles, D.H., She vach, E.M., and Strober, W., eds.) 2006. Current Protocols in Immunology. John Wiley & Sons, Hoboken, N.J.
	Ellison, M.J. and Hochstrasser, M. 1991. Epitope‐tagged ubiquitin. A new probe for analyzing ubiquitin function. J. Biol. Chem. 266:21150‐21157.
	Engebrecht, J., Brent, R., and Kaderbhai, M.A. 1991. Minipreps of plasmid DNA. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Sei dman, J.A. Smith, and K. Struhl, eds.) pp. 1.6.1‐1.6.10. John Wiley & Sons, Hoboken, N.J.
	Fang, S., Jensen, J.P., Ludwig, R.L., Vousden, K.H., and Weissman, A.M. 2000. Mdm2 is a RING finger‐dependent ubiquitin protein ligase for itself and p53. J. Biol. Chem. 275:8945‐8951.
	Fang, S. and Weissman, A.M. 2004. A field guide to ubiquitylation. Cell Mol. Life Sci. 61:1546‐1561.
	Glickman, M. H. and Ciechanover, A. 2002. The ubiquitin‐proteasome proteolytic pathway: Destruction for the sake of construction. Physiol. Rev. 82:373‐428.
	Groll, M. and Huber, R. 2004. Inhibitors of the eukaryotic 20S proteasome core particle: A structural approach. Biochim. Biophys. Acta 1695:33‐44.
	Häkli, M., Lorick, K.L., Weissman, A.M., Janne, O.A., and Palvimo, J.J., 2004. Transcriptional coregulator SNURF (RNF4) possesses ubiquitin E3 ligase activity FEBS Lett. 560:56‐62.
	Hatakeyama, S., Yada, M., Natsumoto, M., Ishida, N., and Nakayama, K.I. 2001. U box proteins as a new family of ubiquitin‐protein ligases. J. Biol. Chem. 276:33111‐33120.
	Hatfield, P.M., Callis, J., and Vierstra, R.D. 1990. Cloning of ubiquitin activating enzyme from wheat and expression of a functional protein in Escherichia coli. J. Biol. Chem. 265:15813‐15817.
	Heitz, F., Nay, C., and Guenet, C. 1997. Expression of functional human muscarinic M2 receptors in different insect cell lines. J. Recept. Signal Transduct. Res. 17: 305‐317.
	Huibregtse, J.M., Scheffner, M., and Howley, P.M. 1993. Cloning and expression of the cDNA for E6‐AP, a protein that mediates the interaction of the human papillomavirus E6 oncoprotein with p53. Mol. Cell Biol. 13:775‐784.
	Imajoh‐Ohmi, S., Kawaguchi, T., Sugiyama, S., Tanaka, K., Omura, S., and Kikuchi, H. 1995. Lactacystin, a specific inhibitor of the proteasome, induces apoptosis in human monoblast U937 cells. Biochem. Biophys. Res. Commun. 217:1070‐1077.
	Iwai, K., Ya manaka, K., Kamura, T., Minato, N., Conaway, R.C., Conaway, J.W., Klausner, R.D., and Pause, A. 1999. Identification of the von Hippel‐lindau tumor‐suppressor protein as part of an active E3 ubiquitin ligase complex. Proc. Natl. Acad. Sci. U.S.A 96:12436‐12441.
	Johnson, E.S. and Gupta, A.A. 2001. An E3‐like factor that promotes SUMO conjugation to the yeast septins. Cell 106:735‐744.
	Kamura, T., Conrad, M.N., Yan, Q., Conaway, R.C., and Conaway, J.W. 1999. The Rbx1 subunit of SCF and VHL E3 ubiquitin ligase activates Rub1 modification of cullins Cdc53 and Cul2. Genes Dev. 13:2928‐933.
	Kawakami, T., Chiba, T., Suzuki, T., Iwai, K., Ya manaka, K., Minato, N., Suzuki, H., Shim bara, N., Hidaka, Y., Osaka, F., Omata, M., and Tanaka, K. 2001. NEDD8 recruits E2‐ubiquitin to SCF E3 ligase. EMBO J. 20:4003‐4012.
	Lorick, K.L., Jensen, J.P., Fang, S., Ong, A.M., Hatakeyama, S., and Weissman, A.M. 1999. RING fingers mediate ubiquitin‐conjugating enzyme (E2)‐dependent ubiquitination. Proc. Natl. Acad. Sci. U.S.A. 96:11364‐11369.
	Lorick, K. L., Jensen, J.P., and Weissman, A.M. 2005a. Expression, purification and properties of the Ubc4/5 family of E2 enzymes. Methods Enzymol. 398:54‐68.
	Lorick, K.L., Tsai, Y.‐C., Yang, Y., and Weissman, A.M. 2005b. RING fingers and relatives: Determinators of protein fate. In Protein Degradation. Vol. 1: Ubiquitin and the Chemistry of Life (R.J. Mayer, A.J. Ciechanover, and M. Rechsteiner, eds.) pp. 4‐101. Wiley‐VCH, Weinheim, Germany.
	Mahaffey, D. and Rechsteiner, M. 1999. Discrimination between ubiquitin‐dependent and ubiquitin‐independent proteolytic pathways by the 26S proteasome subunit 5a. FEBS Lett. 450:123‐125.
	Maki, C.G., Huibregtse, J.M., and Howley, P.M. 1996. In vivo ubiquitination and proteasome‐mediated degradation of p53(1). Cancer Res. 56:2649‐2654.
	Mc Cormack, T., Baumeister, W., Grenier, L., Moomaw, C., Plamondon, L., Pramanik, B., Slaughter, C., Soucy, F., Stein, R., Zuhl, F., and Dick, L. 1997. Active site‐directed inhibitors of Rhodococcus 20 S proteasome: Kinetics and mechanism. J. Biol. Chem. 272:26103‐26109.
	Megumi, Y., Miyauchi, Y., Sakurai, H., Nobeyama, H., Lorick, K., Nakamura, E., Chiba, T., Tanaka, K, Weissman, A.M., Kirisako, T., Ogawa, O., and Iwai, K. 2005. Multiple roles of Rbx1 in the VBC‐Cul2 ubiquitin ligase complex Genes Cells 10:679‐691.
	Murakami, Y., Matsufuji, S., Kameji, T., Hayashi, S., Igarashi, K., Tamura, T., Tanaka, K., and Ichihara, A. 1992. Ornithine decarboxylase is degraded by the 26S proteasome without ubiquitination. Nature 360:597‐599.
	Murakami, Y., Matsufuji, S., Tanaka, K., Ichihara, A., and Hayashi, S. 1993. Involvement of the proteasome and antizyme in ornithine decarboxylase degradation by a reticulocyte lysate. Biochem J. 295:305‐308.
	Murphy, C.I., Piwnica‐Worms, H., Grünwald, S., Romanow, W.G., Francis, N., and Fan, H.‐Y. 2004. Maintainance of insect cell cultures and generation of recombinant baculoviruses. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 16.10.1‐16.10.19. John Wiley & Sons, Hoboken, N.J.
	Naujokat, C., Sezer, O., Zinke, H., Leclere, A., Hauptmann, S., and Possinger, K. 2000. Proteasome inhibitors induced caspase‐dependent apoptosis and accumulation of p21WAF1/Cip1 in human immature leukemic cells. Eur. J. Haematol. 65:221‐236.
	Newman, R.M., Mobascher, A., Mangold, U., Koika, C., Diah, S., Schmidt, M., Finley, D., and Zeiter, B.R. 2004. Antizyme targets cyclin D1 for degradation: A novel mechanism for cell growth repression. J. Biol. Chem. 279:41504‐41511.
	Sambrook, J.F., Frisch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
	Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 1.8.1‐1.8.10. John Wiley & Sons, Hoboken, N.J.
	Skowyra, D., Koepp, D.M., Kamura, T., Conrad, M.N, Conaway, R.C., Conaway, J.W., Elledge, S.J., and Harper, J.W. 1999. Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science 284:662‐665.
	Studier, F.W., Rosenberg, A.H., Dunn, J.J., and Dubendorff, J.W. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60‐89.
	Tanaka, K., Suzuki, T., and Chiba, T. 1998. The ligation systems for ubiquitin and ubiquitin‐like proteins. Mol. Cells 8:503‐512.
	Voytas, D. 2000. Agarose gel electrophoresis. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 2.5A.1‐2.5A.9. John Wiley & Sons, Hoboken, N.J.
	Wang, W., Yum, L., and Beinfeld, M.C. 1997. Expression of rat pro cholecystokinin (CCK) in bacteria and in insect cells infected with recombinant baculovirus. Peptides 18:1295‐1299.
	Weissman, A. M. 2001. Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell Biol. 2:169‐178.
	Wilkinson, K.D. 1997. Regulation of ubiquitin‐dependent processes by deubiquitinating enzymes FASEB J. 11:1245‐1256.
	Wu, P.Y., Hanlon, M., Eddins, M., Tsui, C., Rogers, R.S., Jensen, J.P., Matunis, M.J., Weissman, A.M., Wolberger, C.P., and Pickart, C.M. 2003. A conserved catalytic residue in the ubiquitin‐conjugating enzyme family FASEB J. 22:5241‐5250.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Studies of the Ubiquitin Proteasome System

Abstract

Table of Contents

Materials

Basic Protocol 1: Thiolester Formation Between Rabbit E1 and Ubiquitin

Basic Protocol 2: Thiolester Formation Between E2 and Ubiquitin

Basic Protocol 3: Binding of E2s to E3s

Alternate Protocol 1: Binding of Ubiquitin Substrates to E3s

Basic Protocol 4: E3 Auto‐Ubiquitylation

Basic Protocol 5: Determination of Auto‐Ubiquitylation versus Pseudo‐Substrate Ubiquitylation

Basic Protocol 6: Ubiquitylation of E3 Enzymes Expressed in In Vitro Translation Systems

Alternate Protocol 2: Determination of Ubiquitin Chain Variant Phenotype

Basic Protocol 7: Chelation of Zinc from RING‐ and PHD‐Finger E3s

Alternate Protocol 3: Inhibition of HECT Domain E3s by Alkylation of Active‐Site Cysteines

Basic Protocol 8: Substrate Ubiquitylation in Solution

Alternate Protocol 4: Substrate Ubiquitylation After E3 Binding

Basic Protocol 9: Substrate Ubiquitylation by Multisubunit E3s

Basic Protocol 10: Detection of E3 Activity in Immunoprecipitated Protein

Alternate Protocol 5: Detection of Ubiquitin Modification of Substrates After GST Pull‐Down

Basic Protocol 11: Lysis and Immunoprecipitation of Ubiquitylated Protein

Alternate Protocol 6: Detection of Protein Ubiquitylation Using Tagged Ubiquitin

Basic Protocol 12: Use of Dominant Negative Ubiquitin Proteins in Cells

Alternate Protocol 7: Use of Small Interfering RNAs (siRNAs) to Reduce Expression of Ubiquitin‐Proteasome System Proteins in Cells

Basic Protocol 13: Localizing Degradation to the Proteasome

Basic Protocol 14: Purification of APP‐BP1/Uba3 Complex (E1 for NEDD8) Expressed Using the Baculovirus Expression System

Support Protocol 1: Batch Purification of APP‐BP1 and Uba3

Support Protocol 2: Column Purification of APP‐BP1 and Uba3

Basic Protocol 15: Production of Ubc12 and NEDD8 in Bacterial Expression Systems

Basic Protocol 16: In Vitro Neddylation

Basic Protocol 17: Radiolabeling Ubiquitin with 32P

Alternate Protocol 8: Radiolabeling Ubiquitin with 125Iodine

Alternate Protocol 9: Labeling Ubiquitin with Nonradioactive Tag (Biotin)

Alternate Protocol 10: Generation of Tagged Ubiquitin Expression Plasmids

Basic Protocol 18: Immunoblotting with Anti‐Ubiquitin

Basic Protocol 19: Generation and Purification of Anti‐Ubiquitin Antibodies

Support Protocol 3: Preparation of Ubiquitin Affinity Column

Basic Protocol 20: Preparation of Wheat E1 in E. coli

Basic Protocol 21: Preparation of Mouse E1 in Insect Cells Using a Baculovirus System

Alternate Protocol 11: Preparation of Rabbit E1

Support Protocol 4: Generation of Empty Bacterial Lysates

Basic Protocol 22: Expression of E2s in E. coli Without a Purification Tag

Alternate Protocol 12: Purification of E2s from E. coli Using an Affinity Tag

Alternate Protocol 13: Purification of E2s from E. coli Using Anti–Affinity Tag Antibodies

Basic Protocol 23: Expression of E2s with in Vitro Transcription and Translation Systems

Basic Protocol 24: Expression of Ring‐Finger E3s in Bacterial Lysates

Figures

Videos

Literature Cited