Synthesis of Peptide‐Oligonucleotide Conjugates Using a Heterobifunctional Crosslinker

互联网2013-12-31

1640

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

Peptide?oligonucleotide conjugates (POCs) are molecular chimeras composed of a nucleic acid moiety covalently attached to a polypeptide moiety. POCs have been used in numerous applications from therapeutics to nanotechnology, and most recently as combinatorial agents in the assembly of bivalent protein affinity reagents. This unit describes the synthesis and purification of POC molecules using the heterobifunctional crosslinking reagent succinimidyl?4?(N?maleimidomethyl)cyclohexane?1?carboxylate (SMCC), which enables amine?modified oligonucleotides to become covalently linked to cysteine?modified polypeptides. This solution?based protocol consists of a two?step synthesis followed by a single purification step. Curr. Protoc. Nucleic Acid Chem. 42:4.41.1?4.41.20. © 2010 by John Wiley & Sons, Inc.

Keywords: peptide?oligonucleotide conjugate; succinimidyl?4?(N?maleimidomethyl)cyclohexane?1?carboxylate (SMCC); fragment conjugation; antisense; DNA nanotechnology; synbodies; nanodisplay

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: Purification of Amine‐Modified Oligodeoxynucleotide
Basic Protocol 2: Conjugation of SMCC to the Amine‐Modified Oligonucleotide
Basic Protocol 3: Conjugation of SMCC‐Oligonucleotide to a Cysteine‐Containing Peptide
Basic Protocol 4: Purification of Peptide‐Oligonucleotide Conjugates Using native‐PAGE
Alternate Protocol 1: Purification of Peptide‐Oligonucleotide Conjugates Using Reversed‐Phase HPLC
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Purification of Amine‐Modified Oligodeoxynucleotide

Materials

Acrylamide (Promega)
8 M urea (BDH)
Bisacrylamide (Promega)
10× TBE buffer (see recipe )
10% (w/v) ammonium persulfate (APS, EMD Biosciences)
N′,N′,N′,N′ , Tetraethylmethylenediamine (TEMED, Pierce)
Amine‐modified oligonucleotide
50 mM ethylenediaminetetraacetic acid, pH 8.0 (EDTA, Pierce)
Running dye: 0.05% (w/v) bromophenol blue and 0.05% (w/v) xylene cyanol in 1× TBE buffer (see recipe )
Gel elution buffer (see recipe )
3 M sodium acetate, pH 5.2 (Sigma)
Absolute ethanol (Sigma)
70% ethanol

Gel plates (19.7 × 16– and 19.7 × 18.5–cm)
Spacers (1.5‐mm thick)
Comb (1 well with 2 marker lanes)
100‐mL beaker
Magnetic stir bar and stir plate
Electrophoresis apparatus
50‐mL plastic syringe
Power supply
Heating block
1.5‐mL disposable tubes
Plastic transfer pipets (pulled capillary)
Spatula
Plastic wrap
UV‐active thin‐layer chromatography (TLC) plate
Handheld UV lamp (254 nm)
Black permanent marker
Razor blade or scalpel
Ultrafiltration spin filter tubes (0.45‐µm, Millipore)
Microcentrifuge
Vortex

Basic Protocol 2: Conjugation of SMCC to the Amine‐Modified Oligonucleotide

Materials

Purified amine‐modified oligonucleotide (see protocol 1 )
Ultrapure water
100 mM KH₂ PO₄ buffer, pH 7.2 (BDH)
Succinimidyl‐4‐(N‐maleimidomethyl)cyclohexane‐1‐carboxylate (SMCC; Pierce)
Acetonitrile (Sigma)
Absolute ethanol (Sigma)
70% ethanol
3 M sodium acetate, pH 5.2 (Sigma)

1.5‐mL disposable tubes
Vortex
Microcentrifuge

Basic Protocol 3: Conjugation of SMCC‐Oligonucleotide to a Cysteine‐Containing Peptide

Materials

Polypeptide (>98% purity)
SMCC‐oligonucleotide (see protocol 2 )
100 mM KH₂ PO₄ buffer, pH 7.2 (BDH)

1.5‐mL siliconized disposable tubes (Fisher)
Vortex
Microcentrifuge

Basic Protocol 4: Purification of Peptide‐Oligonucleotide Conjugates Using native‐PAGE

Materials

40% (19:1) acrylamide/bisacrylamide solution (BioRad)
10× TAE‐Mg²⁺ (see recipe )
10% ammonium persulfate (APS, EMD Biosciences)
N′,N′,N′,N′ , Tetraethylmethylenediamine (TEMED, Pierce)
Glycerol (BDH)
Crude POC material (see protocol 3 )
Native running dye: 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol, 80% (v/v) glycerol
SyberGold (Invitrogen), optional

Gel plates (19.7 × 16–cm and 19.7 × 18.5–cm)
Spacers (1.5‐mm thick)
Comb (10‐wells)
100‐mL beaker
Stir bar and stir plate
Electrophoresis apparatus
Power supply
50‐mL syringes
NAP‐10 (GE Lifesciences)
1.5‐mL siliconized disposable tubes (Fisher)
Lyophilizer

Alternate Protocol 1: Purification of Peptide‐Oligonucleotide Conjugates Using Reversed‐Phase HPLC

Materials

HPLC mobile phase B: acetonitrile (HPLC‐grade, Sigma)
HPLC mobile phase A: 0.1 M ammonium acetate, pH 7.0
Crude POC material (see protocol 3 )
0.1 M ammonium acetate, pH 7.0
Nanopure water

High‐performance liquid chromatography (HPLC) system with:
- Injector (autosampler preferred), sample loop, and syringe (for manual injections)
- Binary pumping system
- UV/Vis detector with wavelength detection between 200 and 300 nm
- Analytical column: reversed‐phase column (i.e., Source 5RPC ST 4.6/150, Amersham)
- Semi‐preparative column: reversed‐phase column (i.e., Source 15RPC ST 4.6/100, Amersham)
- Automatic fraction collector (optional)
Nap‐10 columns
Lyophilizer

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 4.41.1 Example of heterobifunctional crosslinking reagents that contain maleimide and succinimidyl ester moieties, all of which are compatible with the protocols described in this unit.

View Image

Figure 4.41.2 Amine‐modified oligonucleotide conjugation to a cysteine‐containing peptide using the heterobifunctional crosslinking reagent SMCC.

View Image

Figure 4.41.3 Amine‐modified deoxynucleotide phosphoramidite and CPG reagents available from Glen Research that can be used as building blocks to construct amine‐modified deoxyoligonucleotides.

View Image

Figure 4.41.4 Conjugation of SMCC to an amine‐modified deoxyoligonucleotide.

View Image
Figure 4.41.5 Conjugation of SMCC‐oligonucleotide to a cysteine‐containing polypeptide.

View Image

Figure 4.41.6 Reversed‐phase HPLC analysis of (A ) the c‐myc peptide (EQKLISEEDLC), (B ) crude POC material (EQKLISEEDLC‐ACCAGCTGTGCAGGCCTCGC), and (C ) 1 nmol of SMCC‐oligonucleotide spiked into the POC mixture (Williams, ).

View Image

Figure 4.41.7 MALDI mass spectroscopy analysis of (A ) SMCC‐oligonucleotide and (B ) purified POC material (Williams, ).

View Image

Figure 4.41.8 Native‐PAGE mobility shift analysis of POC material. Retardation of mobility is observed between the ssDNA (ACCAGCTGTGCAGGCCTCGC) (lane1), SMCC‐oligonucleotide (SMCC‐ACCAGCTGTGCAGGCCTCGC) hybridized to its complementary strand (lane 2), and POC (EQKLISEEDLC‐ACCAGCTGTGCAGGCCTCGC) hybridized to its complementary strand (lane 3), thereby confirming the presence of the polypeptide (Williams et al., ). Image reproduced with permission from Wiley‐VCH Verlag GmbH & Co

View Image

Videos

Literature Cited

Literature Cited
	Brewer, C.F. and Riehm, J.P. 1967. Evidence for possible nonspecific reactions between N‐ethylmaleimide and proteins. Anal. Biochem. 18:248‐255.
	Fasman, G.D. 1975. Handbook of Biochemistry and Molecular Biology. Vol. 1: 3rd Edition, p. 589. CRC Press. Boca Raton, Florida.
	Grandas, A., Marchan, V., Debethune, L., and Pedroso, E. 2007. Stepwise solid‐phase synthesis of nucleopeptides. Curr. Protoc. Nucleic Acid Chem. 31:4.22.1‐4.22.54.
	Haralambidis, J., Duncan, L., Angus, K., and Tregear, G.W. 1990. The synthesis of polyamide‐oligonucleotide conjugate molecules. Nucleic Acids Res. 18:493‐499.
	Harrison, J.G. and Balasubramanian, S. 1997. A convenient synthetic route to oligonucleotide conjugates. Bioorg. Med. Chem. Lett. 7:1041‐1046.
	Harrison, J.G. and Balasubramanian, S. 1998. Synthesis and hybridization analysis of a small library of peptide‐oligonucleotide conjugates. Nucleic Acids Res. 26:3136‐3145.
	Leonetti, J.P., Degols, G., and Lebleu, B. 1990. Biological activity of oligonucleotide‐poly(L‐lysine) conjugates: Mechanism of cell uptake. Bioconj. Chem. 1:149‐153.
	Moroder, H., Steger, J., Graber, D., Fauster, K., Trappl, K., Marquez, V., Polacek, N., Wilson, D.N., and Micura, R. 2009. Non‐hydrolyzable RNA‐peptide conjugates: A powerful advance in the synthesis of mimics for 3 prime‐peptidyl tRNA termini. Angew. Chem. 121:4116‐4120.
	Portela, C., Albericio, F., Eritja, R., Castedo, L., and Mascarenas, J.L. 2007. Ds‐oligonucleotide‐peptide conjugates featuring peptides from the leucine‐zipper region of Fos as switchable receptors for the oncoprotein Jun. Chem. Bio. Chem. 8:1110‐1114.
	Roberts, R.W. and Szostak, J.W. 1997. RNA‐peptide fusions for the in vitro selection of peptides and proteins. Proc. Natl. Acad. Sci. U.S.A. 94:122297‐112302.
	Singh, Y., Spinelli, N., and Defrancq, E. 2008. Chemical strategies for oligonucleotide‐conjugates synthesis. Curr. Org. Chem. 12:263‐290.
	Soukchareun, S., Tregear, G.W., and Haralambidis, J. 1995. Preparation and characterization of antisense oligonucleotide‐peptide hybrids containing viral fusion peptides. Bioconj. Chem. 6:43‐53.
	Stearns, L.A., Chhabra, R., Sharma, J., Liu, Y., Petuskey, W.T., Yan, H., and Chaput, J.C. 2009. Template‐directed nucleation and growth of inorganic nanoparticles on DNA scaffolds. Angew. Chem. Int. Ed. 48:8494‐8496.
	Tengvall, U., Auirola, S., Antopolsky, M., Azhaev, A., and Beigelman, L. 2003. Characterization of antisense oligonucleotide‐peptide conjugates with negative ionization electrospray mass spectrometry and liquid chromatography‐mass spectrometry. J. Pharma. Biomed. Anal. 32:581‐590.
	Tournier, E.J.M., Wallach, J., and Blond, P. 1998. Sulfosuccinimidyl 4‐(N‐maleimidomethyl)‐1‐cyclohexane carboxylate as a bifunctional immobilization agent. Optimization of the coupling conditions. Anal. Chimica Acta 361:33‐44.
	Tung, C.‐H. 2000. Preparation and application of peptide‐oligonucleotide conjugates. Bioconj. Chem. 11:605‐618.
	Venkatesan, N. and Kim, B.H. 2006. Peptide conjugates of oligonucleotides: Synthesis and applications. Chem. Rev. 106:3712‐3761.
	Williams, B.A.R., Lund, K., Liu, Y., Yan, H., and Chaput, J.C. 2007. Self‐assembled peptide nanoarrays: An approach to studying protein‐protein interactions. Angew. Chem. Int. Ed. 46:3051‐3054.
	Williams, B.A.R., Diehnelt, C.W., Belcher, P., Greving, M., Woodbury, N.W., Johnston, S.A., and Chaput, J.C. 2009. Creating protein affinity reagents by combining peptide ligands on synthetic DNA scaffolds. J. Am. Chem. Soc. 131:17233‐17241.
	Williams, B.A.R. 2010. Designing Recognition Elements Based on DNA Scaffold. Ph.D. thesis, Arizona State University, Tempe, Arizona.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Synthesis of Peptide‐Oligonucleotide Conjugates Using a Heterobifunctional Crosslinker

Abstract

Table of Contents

Materials

Basic Protocol 1: Purification of Amine‐Modified Oligodeoxynucleotide

Basic Protocol 2: Conjugation of SMCC to the Amine‐Modified Oligonucleotide

Basic Protocol 3: Conjugation of SMCC‐Oligonucleotide to a Cysteine‐Containing Peptide

Basic Protocol 4: Purification of Peptide‐Oligonucleotide Conjugates Using native‐PAGE

Alternate Protocol 1: Purification of Peptide‐Oligonucleotide Conjugates Using Reversed‐Phase HPLC

Figures

Videos

Literature Cited