A Homogeneous Assay to Assess GABA Transporter Activity

互联网2013-12-31

1028

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

This unit describes a convenient functional uptake assay for GABA transport into cell lines transiently transfected with GABA transporter?1 (GAT?1) and other GAT isoforms. This facile, homogeneous assay allows for the determination of K _m , V _max , and K _i values. The assay utilizes commercially available microtiter plates that contain scintillant embedded in the bottom of the wells. Whereas a signal is generated as the cell accumulates the labeled neurotransmitter, label in the medium is undetected. While GABA uptake is observed in several cell lines transfected with GAT?1, K _m values for GABA uptake may vary with the cell line. This indicates that the choice of cell line is an important consideration when conducting uptake assays.

Keywords: GABA; transporter; functional; uptake; GAT; transient; transfection

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Basic Protocol 1: Measurement of GABA Uptake in Transiently Transfected Cell Lines
Alternate Protocol 1: Batch Transfection of Cell Lines for GABA Uptake Assay
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Measurement of GABA Uptake in Transiently Transfected Cell Lines

Materials

Lennox broth (Fisher Scientific)
Carbenicillin (Sigma)
I.M.A.G.E. clone (ID no. 5264672) for GAT‐1 (Invitrogen); supplied as a frozen, glycerol stock
Mini‐prep and midi‐prep kits (Promega)
Sense oligomer: 5′‐GATATC CACC ATGGCGACCAACGGCAGCAAG‐3′ (Eco RV restriction site underlined; consensus Kozak sequence in bold)
Antisense oligomer: 5′‐GAATTCCTAGATGTAGGCCTCCTTGC‐3′ (Eco RI restriction site underlined)
Gel filtration unit
Pfx polymerase kit (Invitrogen)
0.8% SeaChem ME agarose gel (FMC; see Voytas, )
TAE buffer (see recipe )
Ethidium bromide
GENECLEAN II kit (Qbiogene)
TOPO TA cloning kit (Invitrogen)
LB agar plates ( appendix 2A )
Eco RV and Eco RI endonucleases (Promega)
pIRESpuro3 (Clontech)
High‐mass DNA ladder (Invitrogen)
T4 DNA ligase and 10× buffer
Hexammine cobalt III chloride (e.g., Sigma)
E. coli DH5α (Invitrogen)
Collagen‐coated Cytostar‐T scintillating microplates (see recipe )
Endotoxin‐free maxi prep kit (Qiagen)
COS‐7 cells (ATCC no. CRL‐1651)
Growth medium for cells, warmed to 37°C (see recipe )
Calcium‐ and magnesium‐free PBS (CMF‐PBS; e.g., Invitrogen)
0.25% trypsin/0.1% EDTA solution
0.4% trypan blue solution in CMF‐PBS
Opti‐MEM I serum‐free medium (Invitrogen)
Lipofectamine 2000 transfection reagent (Invitrogen)
Dulbecco's modified eagle medium (DMEM) with 4.5 g/liter glucose, with and without 1× L glutamine (add from 100 × L‐glutamine stock, e.g., Invitrogen)
GAT uptake buffer (see recipe ) with and without 4× (3.2% v/v) dimethylsulfoxide (DMSO)
GAT‐1 inhibitor compounds (see recipe ), e.g., CI‐966 (Tocris) and NO‐711 (Sigma)
GABA substrate for GAT‐1 (see recipe )
10× GABA stop solution (see recipe )

Mini submarine electrophoresis unit
Hemacytometer
Multichannel pipettor
Cell washer (Labsystems; optional)
Jitterbug (Boekel Scientific; optional)
Plate sealer tape for 96‐well microtiter plates
Microtiter plate scintillation counter
Curve‐fitting software (e.g., Prism; GraphPad)
Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

NOTE: All cell culture incubations are performed in a 37°C, 10% CO₂ humidified incubator.NOTE: Prior to conducting the uptake assays, all cell cultures are handled in a sterile field in a laminar flow biosafety cabinet. All materials coming into contact with cell cultures should be sterile.NOTE: Uptake assays are performed at 37°C using a plate warmer, and microtiter plates are handled at the bench.CAUTION: Radioactive material should be handled and disposed of appropriately, including microtiter plates and well contents.

Alternate Protocol 1: Batch Transfection of Cell Lines for GABA Uptake Assay

Materials

HEK‐293 cells (ATCC no. CRL‐1573)
0.4% trypan blue solution
HEK‐293 growth medium
GAT plasmid DNA
Opti‐MEM I serum‐free medium (Invitrogen)
Lipofectamine 2000 transfection reagent (Invitrogen)
Serum‐free DMEM with 4.5 g/liter glucose, without glutamine
Poly‐L‐ornithine hydrobromide and laminin (see recipe )
Calcium‐ and magnesium‐free PBS (CMF‐PBS)
0.25% trypsin/0.1% EDTA

Hemacytometer
100 × 20–mm dishes, tissue‐culture treated (Falcon)
Cytostar‐T scintillating microplates (Amersham Biosciences)

NOTE: All cell culture incubations are performed in a 37°C, 10% CO₂ humidified incubator.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 1.32.1 The K _m for GABA uptake was determined in COS‐7 cells transiently transfected with GAT‐1. The GABA concentration represents a mixture of unlabled:labeled GABA using a constant ratio of 176:1. Alternatively, to achieve a constant ratio, a stock of unlabeled and labeled GABA can be prepared and diluted together in serial dilutions. Nonlinear regression was performed with Prism software using the one‐site binding hyperbola function. Data shown are the average of three independent trials ± the standard deviation. The K _m value was determined to be 11.8 ± 2.9 µM.

View Image

Figure 1.32.2 IC₅₀ curves for inhibitors of GABA uptake. The final concentration of GABA added to the reaction mixture was 15 µM GABA and 8 µCi/ml of [³ H] GABA. The reference compounds are nipecotic acid (filled diamonds), CI‐966 (open circles), and NO‐711 (filled squares). These reference compounds are commercially available from Tocris and Sigma, respectively. Nonlinear regressions were performed with Prism software using the sigmoidal dose‐response curve and variable slope function. Data shown are the average of three independent trials ± the standard deviation. The IC₅₀ values were determined to be 25.0 ± 7.4 mM, 0.51 ± 0.16 mM, and 0.35 ± 0.12 mM for nipecotic acid, CI‐966, and NO‐711, respectively.

View Image

Figure 1.32.3 Flow chart showing time considerations for the in‐plate transfection protocol (see ) and batch‐transfection procedure (see ).

View Image

Videos

Literature Cited

Literature Cited
	Borden, L.A., Smith, K.E., Hartig, P.R., Branchek, T.A., and Weinshank, R.L. 1992. Molecular heterogeneity of the gamma‐aminobutyric acid transport system. J. Biol. Chem. 267:21098‐21104.
	Borden, L.A., Dhar, T.G.M., Smith, K.E., Weinshank, R.L., Branchek, T.A., and Gluchowski, C. 1994. Tiagabine, SK&F 89976‐A, CI‐966, and NNC‐711 are selective for the cloned GABA transporter GAT‐1. Eur. J. Pharmacol. 269:219‐224.
	Braestrup, C., Nielsen, E.B., Sonnewald, U., Knutsen, L.J.S., Andersen, K.E., Jansen, J.A., Frederiksen, K., Andersen, P.H., Mortensen, A., and Suzdak, P.D. 1990. (R)‐N‐[4,4‐Bis(3‐methyl‐2‐thienyl)but‐en‐l‐yl]nipecotic acid binds with high affinity to the brain gamma‐aminobutyric acid uptake carrier. J. Neurochem. 54:639‐647.
	Corey, J.L., Guastella, J., Davidson, N., and Lester, H.A. 1994. GABA uptake and release by a mammalian cell line stably expressing a cloned rat brain GABA transporter. Mol. Membr. Biol. 11:23‐30.
	Gadea, A. and Lopez‐Colome, A.M. 2001. Glial transporters for glutamate, glycine, and GABA: II. GABA transporters. J. Neurosci. Res. 63:461‐468.
	Law, R.M., Stafford, A., and Quick, M.W. 2000. Functional regulation of gamma‐aminobutyric acid transporters by direct tyrosine phosphorylation. J. Biol. Chem. 275:23986‐23991.
	Sarap, A., Larrson, O.M., and Schousboe, A. 2003. GABA transporters and GABA‐transaminase as drug targets. Curr. Drug Targets CNS Neurol. Disord. 2:269‐277.
	Schousboe, A., Sarap, A., Larrson, O.M., and White, H.S. 2004. GABA transporters as drug targets for modulation of GABAergic activity. Biochem. Pharmacol. 68:1557‐1563.
	Sitte, H.H., Singer, E.A., and Scholze, P. 2002. Bi‐directional transport of GABA in human embryonic kidney (HEK) cells stably expressing the rat GABA transporter GAT‐1. Br. J. Pharmacol. 135:93‐102.
	Voytas, D., 1988. Agarose gel electrophoresis. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 2.5.1‐2.5.9. John Wiley & Sons, Hoboken, N.J.
	Yamauchi, A., Uchida, S., Kwon, H.M., Preston, A.S., Robey, R.B., Garcia‐Perez, A., Burg, M.B., and Handler, J.S. 1992. Cloning of a Na(+)‐ and Cl(−)‐dependent betaine transporter that is regulated by hypertonicity. J. Biol. Chem. 267:649‐652.

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

A Homogeneous Assay to Assess GABA Transporter Activity

Abstract

Table of Contents

Materials

Basic Protocol 1: Measurement of GABA Uptake in Transiently Transfected Cell Lines

Alternate Protocol 1: Batch Transfection of Cell Lines for GABA Uptake Assay

Figures

Videos

Literature Cited